back Return to this vector's summary.
ID   PGEX5GLIC  preliminary; circular DNA; SYN; 4968 BP.
XX
AC   M97937; ATCC77274;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pGEX-5G/LIC - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-4968
RC   pGEX-2T/Sal from pGEX-2T
RC   pGEX-5G/LIC from pGEX-2T/Sal
RA   Haun R.S., Moss J.;
RT   "Ligation-independent cloning of glutathione S-transferase fusion
RT   genes for expression in Escherichia coli";
RL   Gene 112:37-43(1992).
XX
CC   The order of the major features in this plasmid is:pMB1 ori - lacIq -
CC   lacZ' - tac - GST/SalI/SacII/thrombin cleavage site/BamHI - ampR.
CC   Vector is covered by a U.S. patent application and is distributed only
CC   for non-commercial use. (personal communication)
CC   Ligation-independent expression vector for constructing fusion
CC   proteins with a carrier polypeptide (glutathione S-transferase) which
CC   allows single-step affinity purification.
CC   The carrier protein can be removed by thrombin proteolysis.
CC   Preparation of the vector for cloning includes linearization with
CC   SacII, gel purification of the linearized vector, and treatment with
CC   T4 DNA polymerase in the presence of dATP.
CC   Target sequences for cloning are prepared by PCR and do not require
CC   restriction enzyme digestion.
CC   Design of PCR primers permits cloning in any reading frame.
CC   The forward primer should contain 15 nt complementary to nt 5' to the
CC   SacII site of the vector [(5'-3')(GGCCTGGTTCCGCGG)] followed by 12-15
CC   nt corresponding to the target sequence (nt encoding the N-terminal
CC   4-5 aa of the protein).
CC   The reverse primer should contain 14 nt complementary to nt 3' to the
CC   SacII site of the vector [(5'-3') (CTGCGCCTCGCTCC)] followed by 12 nt
CC   complementary to the 3' end of the target sequence.
CC   Annealing the vector and amplification product forms a gapped duplex
CC   molecule that can be used directly to transform bacteria without
CC   ligation.
CC   Both primers should contain a dAMP residue near the sequence
CC   complementary to the vector to terminate the exonucleolytic activity
CC   of subsequent T4
CC   DNA polymerase treatment.
CC   Restriction digests of the clone give the following sizes (kb):
CC   SacII--5.1; PstI--5.1; SalI--5.1; PstI/BamHI--4.0, 0.98. (ATCC staff)
CC   Medium is 1227 LB plus ampicillin.
CC   NM (pGEX-5G/LIC)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (ATCC)
CC   HO (E.coli HB101)(E.coli)(E.coli DH5alpha)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA ()
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pGEX-2T 4948bp, C terminus of GST gene
FT                   mutagenesis, to make SalI at C terminus of GST gene
FT                   -> pGEX-2T/Sal 4948bp
FT                   1. pGEX-2T/Sal remove SalI-BamHI 36bp 931..?,
FT                   \ GST C end 4912bp
FT                   2. oligo SalI-BamHI 56bp
FT                   \ tcgaccatcctccaggaggaggaggaggcctggttcggcggagcgaggcg
FT                   \ cagttg
FT                   -> pGEX-5/LIC 4968bp"
FT   misc_binding    894..899
FT                   /note="SIT SalI EXPERIMENTAL [2]"
FT   repeat_region   909..923
FT                   /note="glycine rich coding region EXPERIMENTAL [2],
FT                   rpt_unit is 909..911"
FT   misc_feature    921..935
FT                   /note="forward ligation-independent cloning sequence
FT                   EXPERIMENTAL [2]"
FT   misc_binding    930..935
FT                   /note="SIT unique SacII cloning site EXPERIMENTAL [2]"
FT   misc_feature    complement(934..947)
FT                   /note="reverse ligation-independent cloning sequence
FT                   EXPERIMENTAL [2]"
FT   misc_binding    950..955
FT                   /note="SIT BamHI EXPERIMENTAL [2]"
FT   misc_binding    955..960
FT                   /note="SIT SmaI EXPERIMENTAL [2]"
FT   misc_binding    960..965
FT                   /note="SIT EcoRI EXPERIMENTAL [2]"
FT   CDS             258..935
FT                   /note="GEN E. coli glutathione transferase gene,
FT                   partial; EXPERIMENTAL [1] [2]"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   promoter        0..0
FT                   /note="PRO E. coli tac"
FT   CDS             0..0
FT                   /note="REP E. coli lacIq repressor gene"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
XX
SQ   Sequence 4968 BP; 1226 A; 1197 C; 1298 G; 1247 T; 0 other;
     acgttatcga ctgcacggtg caccaatgct tctggcgtca ggcagccatc ggaagctgtg
     gtatggctgt gcaggtcgta aatcactgca taattcgtgt cgctcaaggc gcactcccgt
     tctggataat gttttttgcg ccgacatcat aacggttctg gcaaatattc tgaaatgagc
     tgttgacaat taatcatcgg ctcgtataat gtgtggaatt gtgagcggat aacaatttca
     cacaggaaac agtattcatg tcccctatac taggttattg gaaaattaag ggccttgtgc
     aacccactcg acttcttttg gaatatcttg aagaaaaata tgaagagcat ttgtatgagc
     gcgatgaagg tgataaatgg cgaaacaaaa agtttgaatt gggtttggag tttcccaatc
     ttccttatta tattgatggt gatgttaaat taacacagtc tatggccatc atacgttata
     tagctgacaa gcacaacatg ttgggtggtt gtccaaaaga gcgtgcagag atttcaatgc
     ttgaaggagc ggttttggat attagatacg gtgtttcgag aattgcatat agtaaagact
     ttgaaactct caaagttgat tttcttagca agctacctga aatgctgaaa atgttcgaag
     atcgtttatg tcataaaaca tatttaaatg gtgatcatgt aacccatcct gacttcatgt
     tgtatgacgc tcttgatgtt gttttataca tggacccaat gtgcctggat gcgttcccaa
     aattagtttg ttttaaaaaa cgtattgaag ctatcccaca aattgataag tacttgaaat
     ccagcaagta tatagcatgg cctttgcagg gctggcaagc cacgtttggt ggtgtcgacc
     atcctccagg aggaggagga ggcctggttc cgcggagcga ggcgcagttg gatccccggg
     aattcatcgt gactgactga cgatctgcct cgcgcgtttc ggtgatgacg gtgaaaacct
     ctgacacatg cagctcccgg agacggtcac agcttgtctg taagcggatg ccgggagcag
     acaagcccgt cagggcgcgt cagcgggtgt tggcgggtgt cggggcgcag ccatgaccca
     gtcacgtagc gatagcggag tgtataattc ttgaagacga aagggcctcg tgatacgcct
     atttttatag gttaatgtca tgataataat ggtttcttag acgtcaggtg gcacttttcg
     gggaaatgtg cgcggaaccc ctatttgttt atttttctaa atacattcaa atatgtatcc
     gctcatgaga caataaccct gataaatgct tcaataatat tgaaaaagga agagtatgag
     tattcaacat ttccgtgtcg cccttattcc cttttttgcg gcattttgcc ttcctgtttt
     tgctcaccca gaaacgctgg tgaaagtaaa agatgctgaa gatcagttgg gtgcacgagt
     gggttacatc gaactggatc tcaacagcgg taagatcctt gagagttttc gccccgaaga
     acgttttcca atgatgagca cttttaaagt tctgctatgt ggcgcggtat tatcccgtgt
     tgacgccggg caagagcaac tcggtcgccg catacactat tctcagaatg acttggttga
     gtactcacca gtcacagaaa agcatcttac ggatggcatg acagtaagag aattatgcag
     tgctgccata accatgagtg ataacactgc ggccaactta cttctgacaa cgatcggagg
     accgaaggag ctaaccgctt ttttgcacaa catgggggat catgtaactc gccttgatcg
     ttgggaaccg gagctgaatg aagccatacc aaacgacgag cgtgacacca cgatgcctgc
     agcaatggca acaacgttgc gcaaactatt aactggcgaa ctacttactc tagcttcccg
     gcaacaatta atagactgga tggaggcgga taaagttgca ggaccacttc tgcgctcggc
     ccttccggct ggctggttta ttgctgataa atctggagcc ggtgagcgtg ggtctcgcgg
     tatcattgca gcactggggc cagatggtaa gccctcccgt atcgtagtta tctacacgac
     ggggagtcag gcaactatgg atgaacgaaa tagacagatc gctgagatag gtgcctcact
     gattaagcat tggtaactgt cagaccaagt ttactcatat atactttaga ttgatttaaa
     acttcatttt taatttaaaa ggatctaggt gaagatcctt tttgataatc tcatgaccaa
     aatcccttaa cgtgagtttt cgttccactg agcgtcagac cccgtagaaa agatcaaagg
     atcttcttga gatccttttt ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc
     gctaccagcg gtggtttgtt tgccggatca agagctacca actctttttc cgaaggtaac
     tggcttcagc agagcgcaga taccaaatac tgtccttcta gtgtagccgt agttaggcca
     ccacttcaag aactctgtag caccgcctac atacctcgct ctgctaatcc tgttaccagt
     ggctgctgcc agtggcgata agtcgtgtct taccgggttg gactcaagac gatagttacc
     ggataaggcg cagcggtcgg gctgaacggg gggttcgtgc acacagccca gcttggagcg
     aacgacctac accgaactga gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc
     cgaagggaga aaggcggaca ggtatccggt aagcggcagg gtcggaacag gagagcgcac
     gagggagctt ccagggggaa acgcctggta tctttatagt cctgtcgggt ttcgccacct
     ctgacttgag cgtcgatttt tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc
     cagcaacgcg gcctttttac ggttcctggc cttttgctgg ccttttgctc acatgttctt
     tcctgcgtta tcccctgatt ctgtggataa ccgtattacc gcctttgagt gagctgatac
     cgctcgccgc agccgaacga ccgagcgcag cgagtcagtg agcgaggaag cggaagagcg
     cctgatgcgg tattttctcc ttacgcatct gtgcggtatt tcacaccgca taaattccga
     caccatcgaa tggtgcaaaa cctttcgcgg tatggcatga tagcgcccgg aagagagtca
     attcagggtg gtgaatgtga aaccagtaac gttatacgat gtcgcagagt atgccggtgt
     ctcttatcag accgtttccc gcgtggtgaa ccaggccagc cacgtttctg cgaaaacgcg
     ggaaaaagtg gaagcggcga tggcggagct gaattacatt cccaaccgcg tggcacaaca
     actggcgggc aaacagtcgt tgctgattgg cgttgccacc tccagtctgg ccctgcacgc
     gccgtcgcaa attgtcgcgg cgattaaatc tcgcgccgat caactgggtg ccagcgtggt
     ggtgtcgatg gtagaacgaa gcggcgtcga agcctgtaaa gcggcggtgc acaatcttct
     cgcgcaacgc gtcagtgggc tgatcattaa ctatccgctg gatgaccagg atgccattgc
     tgtggaagct gcctgcacta atgttccggc gttatttctt gatgtctctg accagacacc
     catcaacagt attattttct cccatgaaga cggtacgcga ctgggcgtgg agcatctggt
     cgcattgggt caccagcaaa tcgcgctgtt agcgggccca ttaagttctg tctcggcgcg
     tctgcgtctg gctggctggc ataaatatct cactcgcaat caaattcagc cgatagcgga
     acgggaaggc gactggagtg ccatgtccgg ttttcaacaa accatgcaaa tgctgaatga
     gggcatcgtt cccactgcga tgctggttgc caacgatcag atggcgctgg gcgcaatgcg
     cgccattacc gagtccgggc tgcgcgttgg tgcggatatc tcggtagtgg gatacgacga
     taccgaagac agctcatgtt atatcccgcc gtcaaccacc atcaaacagg attttcgcct
     gctggggcaa accagcgtgg accgcttgct gcaactctct cagggccagg cggtgaaggg
     caatcagctg ttgcccgtct cactggtgaa aagaaaaacc accctggcgc ccaatacgca
     aaccgcctct ccccgcgcgt tggccgattc attaatgcag ctggcacgac aggtttcccg
     actggaaagc gggcagtgag cgcaacgcaa ttaatgtgag ttagctcact cattaggcac
     cccaggcttt acactttatg cttccggctc gtatgttgtg tggaattgtg agcggataac
     aatttcacac aggaaacagc tatgaccatg attacggatt cactggccgt cgttttacaa
     cgtcgtgact gggaaaaccc tggcgttacc caacttaatc gccttgcagc acatccccct
     ttcgccagct ggcgtaatag cgaagaggcc cgcaccgatc gcccttccca acagttgcgc
     agcctgaatg gcgaatggcg ctttgcctgg tttccggcac cagaagcggt gccggaaagc
     tggctggagt gcgatcttcc tgaggccgat actgtcgtcg tcccctcaaa ctggcagatg
     cacggttacg atgcgcccat ctacaccaac gtaacctatc ccattacggt caatccgccg
     tttgttccca cggagaatcc gacgggttgt tactcgctca catttaatgt tgatgaaagc
     tggctacagg aaggccagac gcgaattatt tttgatggcg ttggaatt
//