back Return to this vector's summary.
ID   PGH6       preliminary; circular DNA; SYN; 4644 BP.
XX
AC   Y00412; ATCC31539; ATCC40012;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pGH6 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pKB268 from lacUV5
RC   pGH6 from pBR322 & pKB268, lacUV5
RA   ;
RT   ;
RL   Unpublished (1982).
RL   U.S. Patent No. 4,342,832 dated Aug. 3, 1982.
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   This was constructed by inserting a 285 bp EcoRI fragment from pKB268
CC   (containing 2 95 bp lac UV5 promoters separated by heterologous DNA)
CC   into the EcoRI site of pBR322.  The EcoRI site distal to the tetR gene
CC   was destroyed.
CC   Expression of inserts cloned into the EcoRI site can be regulated by
CC   the lac UV5 promoters.
CC   A plasmid expression vector.
CC   pGH6 is available in a bacteria culture as ATCC 31539 or as purified
CC   plasmid DNA as ATCC 40012. (ATCC staff)
CC   Medium is 1227 LB plus ampicillin.
CC   NM (pGH6)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (ATCC)
CC   HO (E.coli 294)(E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pBR322)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. E. coli, lacUV5
FT                   -> pLJ3
FT                   1. pLJ3 EcoRI-EcoRI 283bp, lacUV5/lacUV5 [285bp]
FT                   \ #Y00412
FT                   -> pKB268
FT                   1. pBR322 EcoRI 4361bp 4360..4360
FT                   2. pKB268 EcoRI-EcoRI 283bp, lacUV5/lacUV5
FT                   \ aattctcactcattaggcaccccaggctttacactttatgcttccggct
FT                   \ cgtataatgtgtggaattgtgagcggataacaatttcacacaggaaacag
FT                   \ ctgattgcccttcaccgcctggcctccgttgagccatctggatcggcagc
FT                   \ gttgtcttcatcaaccggaacgagcatgccggagagcagctcactcatta
FT                   \ ggcaccccaggctttacactttatgcttccggctcgtataatgtgtggaa
FT                   \ ttgtgagcggataacaatttcacacaggaaacag
FT                   -> pGH6 4644bp"
FT   -               1..4359
FT                   /note="pBR322 1..4359 4359bp
FT                   EcoRI = G^AATTC"
FT   -               4360..4642
FT                   /note="283bp
FT                   \ aattctcactcattaggcaccccaggctttacactttatgcttccggct
FT                   \ cgtataatgtgtggaattgtgagcggataacaatttcacacaggaaacag
FT                   \ ctgattgcccttcaccgcctggcctccgttgagccatctggatcggcagc
FT                   \ gttgtcttcatcaaccggaacgagcatgccggagagcagctcactcatta
FT                   \ ggcaccccaggctttacactttatgcttccggctcgtataatgtgtggaa
FT                   \ ttgtgagcggataacaatttcacacaggaaacag
FT                   EcoRI = G^AATTC"
FT   -               4643..4644
FT                   /note="pBR322 4360..4361 2bp"
FT   misc_binding    0..0
FT                   /note="SIT unique pBR322 sites"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   promoter        0..0
FT                   /note="PRO E. coli lacUV5 gene"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   CDS             0..0
FT                   /note="ANT E. coli tetracycline resistance gene (tet)"
XX
SQ   Sequence 4644 BP; 1053 A; 1285 C; 1199 G; 1107 T; 0 other;
     ttctcatgtt tgacagctta tcatcgataa gctttaatgc ggtagtttat cacagttaaa
     ttgctaacgc agtcaggcac cgtgtatgaa atctaacaat gcgctcatcg tcatcctcgg
     caccgtcacc ctggatgctg taggcatagg cttggttatg ccggtactgc cgggcctctt
     gcgggatatc gtccattccg acagcatcgc cagtcactat ggcgtgctgc tagcgctata
     tgcgttgatg caatttctat gcgcacccgt tctcggagca ctgtccgacc gctttggccg
     ccgcccagtc ctgctcgctt cgctacttgg agccactatc gactacgcga tcatggcgac
     cacacccgtc ctgtggatcc tctacgccgg acgcatcgtg gccggcatca ccggcgccac
     aggtgcggtt gctggcgcct atatcgccga catcaccgat ggggaagatc gggctcgcca
     cttcgggctc atgagcgctt gtttcggcgt gggtatggtg gcaggccccg tggccggggg
     actgttgggc gccatctcct tgcatgcacc attccttgcg gcggcggtgc tcaacggcct
     caacctacta ctgggctgct tcctaatgca ggagtcgcat aagggagagc gtcgaccgat
     gcccttgaga gccttcaacc cagtcagctc cttccggtgg gcgcggggca tgactatcgt
     cgccgcactt atgactgtct tctttatcat gcaactcgta ggacaggtgc cggcagcgct
     ctgggtcatt ttcggcgagg accgctttcg ctggagcgcg acgatgatcg gcctgtcgct
     tgcggtattc ggaatcttgc acgccctcgc tcaagccttc gtcactggtc ccgccaccaa
     acgtttcggc gagaagcagg ccattatcgc cggcatggcg gccgacgcgc tgggctacgt
     cttgctggcg ttcgcgacgc gaggctggat ggccttcccc attatgattc ttctcgcttc
     cggcggcatc gggatgcccg cgttgcaggc catgctgtcc aggcaggtag atgacgacca
     tcagggacag cttcaaggat cgctcgcggc tcttaccagc ctaacttcga tcactggacc
     gctgatcgtc acggcgattt atgccgcctc ggcgagcaca tggaacgggt tggcatggat
     tgtaggcgcc gccctatacc ttgtctgcct ccccgcgttg cgtcgcggtg catggagccg
     ggccacctcg acctgaatgg aagccggcgg cacctcgcta acggattcac cactccaaga
     attggagcca atcaattctt gcggagaact gtgaatgcgc aaaccaaccc ttggcagaac
     atatccatcg cgtccgccat ctccagcagc cgcacgcggc gcatctcggg cagcgttggg
     tcctggccac gggtgcgcat gatcgtgctc ctgtcgttga ggacccggct aggctggcgg
     ggttgcctta ctggttagca gaatgaatca ccgatacgcg agcgaacgtg aagcgactgc
     tgctgcaaaa cgtctgcgac ctgagcaaca acatgaatgg tcttcggttt ccgtgtttcg
     taaagtctgg aaacgcggaa gtcagcgccc tgcaccatta tgttccggat ctgcatcgca
     ggatgctgct ggctaccctg tggaacacct acatctgtat taacgaagcg ctggcattga
     ccctgagtga tttttctctg gtcccgccgc atccataccg ccagttgttt accctcacaa
     cgttccagta accgggcatg ttcatcatca gtaacccgta tcgtgagcat cctctctcgt
     ttcatcggta tcattacccc catgaacaga aatccccctt acacggaggc atcagtgacc
     aaacaggaaa aaaccgccct taacatggcc cgctttatca gaagccagac attaacgctt
     ctggagaaac tcaacgagct ggacgcggat gaacaggcag acatctgtga atcgcttcac
     gaccacgctg atgagcttta ccgcagctgc ctcgcgcgtt tcggtgatga cggtgaaaac
     ctctgacaca tgcagctccc ggagacggtc acagcttgtc tgtaagcgga tgccgggagc
     agacaagccc gtcagggcgc gtcagcgggt gttggcgggt gtcggggcgc agccatgacc
     cagtcacgta gcgatagcgg agtgtatact ggcttaacta tgcggcatca gagcagattg
     tactgagagt gcaccatatg cggtgtgaaa taccgcacag atgcgtaagg agaaaatacc
     gcatcaggcg ctcttccgct tcctcgctca ctgactcgct gcgctcggtc gttcggctgc
     ggcgagcggt atcagctcac tcaaaggcgg taatacggtt atccacagaa tcaggggata
     acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg
     cgttgctggc gtttttccat aggctccgcc cccctgacga gcatcacaaa aatcgacgct
     caagtcagag gtggcgaaac ccgacaggac tataaagata ccaggcgttt ccccctggaa
     gctccctcgt gcgctctcct gttccgaccc tgccgcttac cggatacctg tccgcctttc
     tcccttcggg aagcgtggcg ctttctcata gctcacgctg taggtatctc agttcggtgt
     aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg
     ccttatccgg taactatcgt cttgagtcca acccggtaag acacgactta tcgccactgg
     cagcagccac tggtaacagg attagcagag cgaggtatgt aggcggtgct acagagttct
     tgaagtggtg gcctaactac ggctacacta gaaggacagt atttggtatc tgcgctctgc
     tgaagccagt taccttcgga aaaagagttg gtagctcttg atccggcaaa caaaccaccg
     ctggtagcgg tggttttttt gtttgcaagc agcagattac gcgcagaaaa aaaggatctc
     aagaagatcc tttgatcttt tctacggggt ctgacgctca gtggaacgaa aactcacgtt
     aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac ctagatcctt ttaaattaaa
     aatgaagttt taaatcaatc taaagtatat atgagtaaac ttggtctgac agttaccaat
     gcttaatcag tgaggcacct atctcagcga tctgtctatt tcgttcatcc atagttgcct
     gactccccgt cgtgtagata actacgatac gggagggctt accatctggc cccagtgctg
     caatgatacc gcgagaccca cgctcaccgg ctccagattt atcagcaata aaccagccag
     ccggaagggc cgagcgcaga agtggtcctg caactttatc cgcctccatc cagtctatta
     attgttgccg ggaagctaga gtaagtagtt cgccagttaa tagtttgcgc aacgttgttg
     ccattgctgc aggcatcgtg gtgtcacgct cgtcgtttgg tatggcttca ttcagctccg
     gttcccaacg atcaaggcga gttacatgat cccccatgtt gtgcaaaaaa gcggttagct
     ccttcggtcc tccgatcgtt gtcagaagta agttggccgc agtgttatca ctcatggtta
     tggcagcact gcataattct cttactgtca tgccatccgt aagatgcttt tctgtgactg
     gtgagtactc aaccaagtca ttctgagaat agtgtatgcg gcgaccgagt tgctcttgcc
     cggcgtcaac acgggataat accgcgccac atagcagaac tttaaaagtg ctcatcattg
     gaaaacgttc ttcggggcga aaactctcaa ggatcttacc gctgttgaga tccagttcga
     tgtaacccac tcgtgcaccc aactgatctt cagcatcttt tactttcacc agcgtttctg
     ggtgagcaaa aacaggaagg caaaatgccg caaaaaaggg aataagggcg acacggaaat
     gttgaatact catactcttc ctttttcaat attattgaag catttatcag ggttattgtc
     tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg gttccgcgca
     catttccccg aaaagtgcca cctgacgtct aagaaaccat tattatcatg acattaacct
     ataaaaatag gcgtatcacg aggccctttc gtcttcaaga attctcactc attaggcacc
     ccaggcttta cactttatgc ttccggctcg tataatgtgt ggaattgtga gcggataaca
     atttcacaca ggaaacagct gattgccctt caccgcctgg cctccgttga gccatctgga
     tcggcagcgt tgtcttcatc aaccggaacg agcatgccgg agagcagctc actcattagg
     caccccaggc tttacacttt atgcttccgg ctcgtataat gtgtggaatt gtgagcggat
     aacaatttca cacaggaaac agaa
//