back Return to this vector's summary.
ID   PGL101     preliminary; circular DNA; SYN; 2392 BP.
XX
AC   J02460; ATCC37121;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pGL101 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pGL101 from pBR322 & lac operon
RC   pRP12 from pTR161 & lambda imm434
RC   pRP16 from pRP12 & pGL101
RC   pRP28, pRP40, pRP42 from pRP16 & pGL101
RC   pGL102 from pBR322 & lambda imm434, vir
RC   pGL115, pGL139, pGL120 from pGL102 & pGL101
RA   Lauer G., Pastrana R., Sherley J., Ptashne M.;
RT   "Construction of overproducers of the bacteriophage 434 repressor
RT   and cro proteins";
RL   J. Mol. Appl. Genet. 1:139-147(1981).
XX
RN   [2]
RC   pTR116 from pBR322 & lambda
RC   pTR151 from pTR116
RA   Roberts T., Lauer G.;
RT   "Maximizing gene expression on a plasmid using recombination in
RT   vitro";
RL   Meth. Enzymol. 68:473-482(1979).
XX
RN   [3]
RP   1-1287
RC   from lambda imm434
RA   Ovchinnikov Y.A., Guryev S.O., Krayev A.S., Monastyrskaya G.S.,
RA   Skryabin K.G., Sverdlov V.M., Zakharyev V.M., Bayev A.A.;
RT   "Primary structure of an EcoRI fragment of lambda imm 434 DNA
RT   containing regions cI-cro of phage 434 and cII-O of phage lambda";
RL   Gene 6:235-249(1979).
XX
RN   [4]
RP   1-217
RC   phage 434 from E. coli
RC   lambda imm434 from lambda & phage 434
RA   Pirrotta V.;
RT   "Operators and promoters in the or region of phage 434";
RL   Nucleic Acids Res. 6:1495-1508(1979).
XX
RN   [5]
RC   phage 434 from E. coli
RC   lambda dvimm434 from lambda imm434
RC   from lambda dvimm434
RA   Grosschedl R., Schwarz E.;
RT   "Nucleotide sequence of the cro-cII-oop region of bacteriophage
RT   434 DNA";
RL   Nucleic Acids Res. 6:867-881(1979).
XX
RN   [6]
RC   pHL81 from pBR313 & phage 434
RA   Lusky M., Hobom G.;
RT   "Inceptor and origin of DNA replication in lambdoid coliphages. I.
RT   The lambda DNA minimal replication system";
RL   Gene 6:137-172(1979).
XX
RN   [7]
RC   lambda dvimm434 from lambda imm434
RA   Matsubara K., Otsuji Y.;
RT   "Preparation of plasmids from lambdoid phages and studies on their
RT   incompatibilities";
RL   Plasmid 1:284-296(1978).
XX
RN   [8]
RC   pY1rA3 from yeast ribosomal gene
RA   Petes D.T., Hereford L.M., Skryabin K.G.;
RT   "Characterization of two types of yeast ribosomal genes";
RL   J. Bacteriol. 134:295-305(1978).
XX
RN   [9]
RC   pTR161 from lacUV5 promoter
RA   Roberts T.M., Kacich R., Ptashne M.;
RT   "A general method for maximizing th eexpression of a cloned gene";
RL   Proc. Natl. Acad. Sci. U.S.A. 76:760-764(1979).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   Source of E.coli lacZ promoter and ribosome binding site for use
CC   in constructing expression vectors.
CC   Medium is 1227 LB plus ampicillin.
CC   phage lambda imm434 is a hybrid phage in which the immunity region
CC   of lambda is replaced by that of closely related phage 434. lambda
CC   imm434 contains the ci gene, the cro gene and the two operators and
CC   promoters of 434 and therefore responds to the control by the 434
CC   repressor but is insensitive to the lambda repressor. the boundary
CC   of 434 is at base position 361.
CC   NCBI gi: 215173
CC   NM (pGL101)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (ATCC)
CC   HO (E.coli YMC9)(E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pLJ3 from pBR322)(lambda)
CC   BR ()
CC   OF (pRFS10)(pRFS11)
CC   OR (5' end of the ecori-g fragment, polarity of l strand)
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 PvuII-EcoRI 2293bp 2067..4360,
FT                   \ ori/amp gene
FT                   2. E. coli EcoRI-AluI 99bp, lacUV5 promoter-oper
FT                   \ aattctcactcattaggcaccccaggctttacactttatgcttccggctc
FT                   \ gtataatgtgtggaattgtgagcggataacaatttcacacaggaaacag
FT                   \ reversed is AluI-EcoRI 95bp, #Y00412
FT                   \ ctcactcattaggcaccccaggctttacactttatgcttccggctcgtat
FT                   \ aatgtgtggaattgtgagcggataacaatttcacacaggaaacag
FT                   -> pGL101 2392bp"
FT   -               1..2293
FT                   /note="pBR322 2067..4359 2293bp
FT                   EcoRI = G^AATTC"
FT   -               2294..2392
FT                   /note="99bp
FT                   \ aattctcactcattaggcaccccaggctttacactttatgcttccggctc
FT                   \ gtataatgtgtggaattgtgagcggataacaatttcacacaggaaacag
FT                   AluI =   AG^CT
FT                   PvuII = CAG^CTG"
FT   misc_binding    0..0
FT                   /note="SIT unique EcoRI-PvuII"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   promoter        0..0
FT                   /note="PRO E. coli lac gene"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   misc_signal     41..46
FT                   /note="sd sequence for ci"
FT   misc_signal     68..81
FT                   /note="or3 operator"
FT   misc_signal     91..104
FT                   /note="or2 operator"
FT   misc_signal     113..126
FT                   /note="or1 operator"
FT   misc_signal     131..135
FT                   /note="sd sequence for cro"
FT   misc_signal     458..463
FT                   /note="sd sequence for cii"
FT   misc_signal     791..795
FT                   /note="sd sequence for o"
FT   CDS             140..355
FT                   /note="GEN cro; NCBI gi: 215174"
FT   CDS             475..768
FT                   /note="GEN cii; NCBI gi: 215175"
FT   CDS             801..>1287
FT                   /note="GEN o; NCBI gi: 215176"
XX
SQ   Sequence 2392 BP; 608 A; 603 C; 588 G; 593 T; 0 other;
     ctgcctcgcg cgtttcggtg atgacggtga aaacctctga cacatgcagc tcccggagac
     ggtcacagct tgtctgtaag cggatgccgg gagcagacaa gcccgtcagg gcgcgtcagc
     gggtgttggc gggtgtcggg gcgcagccat gacccagtca cgtagcgata gcggagtgta
     tactggctta actatgcggc atcagagcag attgtactga gagtgcacca tatgcggtgt
     gaaataccgc acagatgcgt aaggagaaaa taccgcatca ggcgctcttc cgcttcctcg
     ctcactgact cgctgcgctc ggtcgttcgg ctgcggcgag cggtatcagc tcactcaaag
     gcggtaatac ggttatccac agaatcaggg gataacgcag gaaagaacat gtgagcaaaa
     ggccagcaaa aggccaggaa ccgtaaaaag gccgcgttgc tggcgttttt ccataggctc
     cgcccccctg acgagcatca caaaaatcga cgctcaagtc agaggtggcg aaacccgaca
     ggactataaa gataccaggc gtttccccct ggaagctccc tcgtgcgctc tcctgttccg
     accctgccgc ttaccggata cctgtccgcc tttctccctt cgggaagcgt ggcgctttct
     catagctcac gctgtaggta tctcagttcg gtgtaggtcg ttcgctccaa gctgggctgt
     gtgcacgaac cccccgttca gcccgaccgc tgcgccttat ccggtaacta tcgtcttgag
     tccaacccgg taagacacga cttatcgcca ctggcagcag ccactggtaa caggattagc
     agagcgaggt atgtaggcgg tgctacagag ttcttgaagt ggtggcctaa ctacggctac
     actagaagga cagtatttgg tatctgcgct ctgctgaagc cagttacctt cggaaaaaga
     gttggtagct cttgatccgg caaacaaacc accgctggta gcggtggttt ttttgtttgc
     aagcagcaga ttacgcgcag aaaaaaagga tctcaagaag atcctttgat cttttctacg
     gggtctgacg ctcagtggaa cgaaaactca cgttaaggga ttttggtcat gagattatca
     aaaaggatct tcacctagat ccttttaaat taaaaatgaa gttttaaatc aatctaaagt
     atatatgagt aaacttggtc tgacagttac caatgcttaa tcagtgaggc acctatctca
     gcgatctgtc tatttcgttc atccatagtt gcctgactcc ccgtcgtgta gataactacg
     atacgggagg gcttaccatc tggccccagt gctgcaatga taccgcgaga cccacgctca
     ccggctccag atttatcagc aataaaccag ccagccggaa gggccgagcg cagaagtggt
     cctgcaactt tatccgcctc catccagtct attaattgtt gccgggaagc tagagtaagt
     agttcgccag ttaatagttt gcgcaacgtt gttgccattg ctgcaggcat cgtggtgtca
     cgctcgtcgt ttggtatggc ttcattcagc tccggttccc aacgatcaag gcgagttaca
     tgatccccca tgttgtgcaa aaaagcggtt agctccttcg gtcctccgat cgttgtcaga
     agtaagttgg ccgcagtgtt atcactcatg gttatggcag cactgcataa ttctcttact
     gtcatgccat ccgtaagatg cttttctgtg actggtgagt actcaaccaa gtcattctga
     gaatagtgta tgcggcgacc gagttgctct tgcccggcgt caacacggga taataccgcg
     ccacatagca gaactttaaa agtgctcatc attggaaaac gttcttcggg gcgaaaactc
     tcaaggatct taccgctgtt gagatccagt tcgatgtaac ccactcgtgc acccaactga
     tcttcagcat cttttacttt caccagcgtt tctgggtgag caaaaacagg aaggcaaaat
     gccgcaaaaa agggaataag ggcgacacgg aaatgttgaa tactcatact cttccttttt
     caatattatt gaagcattta tcagggttat tgtctcatga gcggatacat atttgaatgt
     atttagaaaa ataaacaaat aggggttccg cgcacatttc cccgaaaagt gccacctgac
     gtctaagaaa ccattattat catgacatta acctataaaa ataggcgtat cacgaggccc
     tttcgtcttc aagaattctc actcattagg caccccaggc tttacacttt atgcttccgg
     ctcgtataat gtgtggaatt gtgagcggat aacaatttca cacaggaaac ag
//