back Return to this vector's summary.
ID   PGP11      preliminary; circular DNA; SYN; 3232 BP.
XX
AC   IG5166;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pGP11 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pBluescript M13-, pBluescript M13+ from pBluescript & M13
RC   pGP11 from pBluescript M13- & oligo
RC   pGP12 from pGP11 & oligo
RC   pGP76 from pIBI76 & oligo
RC   pST5RD from pGP76 & pXbs201, X. borealis somatic-type 5S RNA gene
RC   pGA1 from pGP11 & pUC3a1.b, X. laevis TFIIIA gene
RC   pGA11 from pGP12 & pUC3a1.b, X. laevis TFIIIA gene
RA   Setzer D.R., Hmiel R.M., Liao S.Y.;
RT   "A simple vector modification to facilitate oligonucleotide-directed
RT   mutagenesis";
RL   Nucleic Acids Res. 18:4175-4178(1990).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   MCS. oligonucleotide linker.
CC   NM (pGP11)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pBluescript M13-)(pIUBI76)(pST5RD from pXbs201 & pGP76)
CC   PA (pGA11 from pUC3a1.b & pGP11)(pGA11 from pUC3a1.b & pGP12)
CC   BR (pGP12)(pGP76)
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBluescript M13- NdeI 3204bp 185..185
FT                   fill in
FT                   EcoRI 3204bp 882..882, MCS
FT                   blunt end:blunt end
FT                   2. oligo 30bp aattcaggaaacagctatgaccatgataca
FT                   -> pGP11 3234bp"
FT   -               1..186
FT                   /note="pBluescript M13- 1..186 186bp
FT                   NdeI = CA^TA TG
FT                   NdeI =    CA^TATG"
FT   -               187..883
FT                   /note="pBluescript M13- 185..881 697bp
FT                   EcoRI = G^AATTC
FT                   \         aattc..."
FT   -               884..913
FT                   /note="aattcaggaaacagctatgaccatgataca 30bp
FT                   \      ...ataca
FT                   EcoRI =  G^AATT C"
FT   -               914..3232
FT                   /note="pBluescript M13- 886..3204 2319bp"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 3232 BP; 788 A; 814 C; 807 G; 823 T; 0 other;
     tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca
     cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg
     ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc
     accatatatg cggtgtgaaa taccgcacag atgcgtaagg agaaaatacc gcatcaggcg
     acgcgccctg tagcggcgca ttaagcgcgg cgggtgtggt ggttacgcgc agcgtgaccg
     ctacacttgc cagcgcccta gcgcccgctc ctttcgcttt cttcccttcc tttctcgcca
     cgttcgccgg ctttccccgt caagctctaa atcgggggct ccctttaggg ttccgattta
     gtgctttacg gcacctcgac cccaaaaaac ttgattaggg tgatggttca cgtagtgggc
     catcgccctg atagacggtt tttcgccctt tgacgttgga gtccacgttc tttaatagtg
     gactcttgtt ccaaactgga acaacactca accctatctc ggtctattct tttgatttat
     aagggatttt gccgatttcg gcctattggt taaaaaatga gctgatttaa caaaaattta
     acgcgaattt taacaaaata ttaacgttta caatttcgcc attcgccatt caggctgcgc
     aactgttggg aagggcgatc ggtgcgggcc tcttcgctat tacgccagct ggcgaaaggg
     ggatgtgctg caaggcgatt aagttgggta acgccagggt tttcccagtc acgacgttgt
     aaaacgacgg ccagtgaatt gtaatacgac tcactatagg gcgaattcag gaaacagcta
     tgaccatgat acacgagctc ggtacccggg gatcctctag agtcgacctg caggcatgca
     agcttttgtt ccctttagtg agggttaatt ccgagcttgg cgtaatcatg gtcatagctg
     tttcctgtgt gaaattgtta tccgctcaca attccacaca acatacgagc cggaagcata
     aagtgtaaag cctggggtgc ctaatgagtg agctaactca cattaattgc gttgcgctca
     ctgcccgctt tccagtcggg aaacctgtcg tgccagctgc attaatgaat cggccaacgc
     gcggggagag gcggtttgcg tattgggcgc tcttccgctt cctcgctcac tgactcgctg
     cgctcggtcg ttcggctgcg gcgagcggta tcagctcact caaaggcggt aatacggtta
     tccacagaat caggggataa cgcaggaaag aacatgtgag caaaaggcca gcaaaaggcc
     aggaaccgta aaaaggccgc gttgctggcg tttttccata ggctccgccc ccctgacgag
     catcacaaaa atcgacgctc aagtcagagg tggcgaaacc cgacaggact ataaagatac
     caggcgtttc cccctggaag ctccctcgtg cgctctcctg ttccgaccct gccgcttacc
     ggatacctgt ccgcctttct cccttcggga agcgtggcgc tttctcatag ctcacgctgt
     aggtatctca gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc
     gttcagcccg accgctgcgc cttatccggt aactatcgtc ttgagtccaa cccggtaaga
     cacgacttat cgccactggc agcagccact ggtaacagga ttagcagagc gaggtatgta
     ggcggtgcta cagagttctt gaagtggtgg cctaactacg gctacactag aaggacagta
     tttggtatct gcgctctgct gaagccagtt accttcggaa aaagagttgg tagctcttga
     tccggcaaac aaaccaccgc tggtagcggt ggtttttttg tttgcaagca gcagattacg
     cgcagaaaaa aaggatctca agaagatcct ttgatctttt ctacggggtc tgacgctcag
     tggaacgaaa actcacgtta agggattttg gtcatgagat tatcaaaaag gatcttcacc
     tagatccttt taaattaaaa atgaagtttt aaatcaatct aaagtatata tgagtaaact
     tggtctgaca gttaccaatg cttaatcagt gaggcaccta tctcagcgat ctgtctattt
     cgttcatcca tagttgcctg actccccgtc gtgtagataa ctacgatacg ggagggctta
     ccatctggcc ccagtgctgc aatgataccg cgagacccac gctcaccggc tccagattta
     tcagcaataa accagccagc cggaagggcc gagcgcagaa gtggtcctgc aactttatcc
     gcctccatcc agtctattaa ttgttgccgg gaagctagag taagtagttc gccagttaat
     agtttgcgca acgttgttgc cattgctaca ggcatcgtgg tgtcacgctc gtcgtttggt
     atggcttcat tcagctccgg ttcccaacga tcaaggcgag ttacatgatc ccccatgttg
     tgcaaaaaag cggttagctc cttcggtcct ccgatcgttg tcagaagtaa gttggccgca
     gtgttatcac tcatggttat ggcagcactg cataattctc ttactgtcat gccatccgta
     agatgctttt ctgtgactgg tgagtactca accaagtcat tctgagaata gtgtatgcgg
     cgaccgagtt gctcttgccc ggcgtcaata cgggataata ccgcgccaca tagcagaact
     ttaaaagtgc tcatcattgg aaaacgttct tcggggcgaa aactctcaag gatcttaccg
     ctgttgagat ccagttcgat gtaacccact cgtgcaccca actgatcttc agcatctttt
     actttcacca gcgtttctgg gtgagcaaaa acaggaaggc aaaatgccgc aaaaaaggga
     ataagggcga cacggaaatg ttgaatactc atactcttcc tttttcaata ttattgaagc
     atttatcagg gttattgtct catgagcgga tacatatttg aatgtattta gaaaaataaa
     caaatagggg ttccgcgcac atttccccga aaagtgccac ctgacgtcta agaaaccatt
     attatcatga cattaaccta taaaaatagg cgtatcacga ggccctttcg tc
//