back Return to this vector's summary.
ID   PHC624     preliminary; circular DNA; SYN; 2019 BP.
XX
AC   M31883; M31882; M31881; J05270;
XX
DT   15-JUN-1990 (Rel. 5, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli K12 plasmid vector pHC624 - complete, lacUV5 promoter & MCS.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-313, first
RP   1-313, second
RP   1-158, MCS
RC   [M13mp9aml6 from M13mp9]
RC   M13mp18am from M13mp18 & M13mp9aml6
RC   pHC624lacI from pHC624 & pDR206, lacUV5 promoter
RA   Chan P.T., Lebowitz J.;
RT   "Site-directed mutagenesis of the -10 region of the lacUV5 promoter.
RT   Introduction of dA4.dT4 tract suppresses open complex formation";
RL   J. Biol. Chem. 265:4091-4097(1990).
XX
RN   [2]
RP   1-313, first
RP   1-313, second
RP   1-158, MCS
RC   pHC624
RA   Lebowitz J.;
RT   ;
RL   Submitted (29-JAN-1990) in computer-readable media by:
RL   Lebowitz J., .
XX
RN   [3]
RC   pHC1 from pBR322
RC   pHC81 from pHC1
RC   pHC314 from pHC81 & piVX
RC   pHC312 from pHC314
RC   pHC624 from pHC312 & piAN7
RA   Boros I., Posfai G., Venetianer P.;
RT   "High-copy-number derivatives of the plasmid cloning vector pBR322";
RL   Gene 30:257-260(1984).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   lacUV5 promoter carries a single base pair change ('t' to 'a')
CC   at the -10 region.
CC   NCBI gi: 208299 & 208300 & 208301
CC   NM (pHC624)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli K-12)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pBR322)(piVX)(piAN7)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 BamHI-EcoRI 3984bp 376..4360
FT                   2. insert 1600bp
FT                   -> pHC1 6000bp
FT                   1. pHC1 large PvuII-EcoRI 2293bp, no oligo insert
FT                   \ pBR322 2293bp 2067..4360
FT                   :Klenow
FT                   -> pHC81 2295bp [unique EcoRI]
FT                   1. pHC81 EcoRI 2295bp 0..0, insert
FT                   2. piVX EcoRI-EcoRI 109bp 2..111, MCS
FT                   \ EcoRI = 2 111 314
FT                   -> pHC314 2405bp
FT                   1. pHC314 HinfI-BamHI 2006bp, 2449..4360/2..97
FT                   \ piVX BamHI = 97
FT                   \ piVX HinfI = 152 187 645
FT                   \ pBR322 HinfI =  633 853 1007 1305 1526 2030 2374
FT                   \ 2449 2845 3362
FT                   Klenow:Klenow
FT                   -> pHC312 2010bp
FT                   \ [unique EcoRI, ClaI, HindIII, XbaI, BglII]
FT                   1. pHC312 EcoRI-HindIII 31bp 2..33
FT                   2. piAN7 EcoRI-HindIII 36bp 204..240
FT                   \ aattcccggggatccgtcgacctgcagatctctaga, MCS
FT                   -> pHC624 2015bp
FT                   \ [unique EcoRI,SmaI,BamHI,SalI,BglII,XbaI,HindIII]"
FT   -               1..1915
FT                   /note="pBR322 2449..4361..2 1915bp
FT                   EcoRI = G^AATT C
FT                   PvuII =    CAG^CTG
FT                   EcoRI = G^AATT C"
FT   -               1916..1951
FT                   /note="aattcccggggatccgtcgacctgcagatctctaga 36bp
FT                   HindIII = A^AGCTT"
FT   -               1952..2019
FT                   /note="piVX 33..100 68bp
FT                   BamHI = G^GATC C
FT                   HinfI =      G^ANTC"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 2019 BP; 525 A; 510 C; 470 G; 514 T; 0 other;
     aatcagggga taacgcagga aagaacatgt gagcaaaagg ccagcaaaag gccaggaacc
     gtaaaaaggc cgcgttgctg gcgtttttcc ataggctccg cccccctgac gagcatcaca
     aaaatcgacg ctcaagtcag aggtggcgaa acccgacagg actataaaga taccaggcgt
     ttccccctgg aagctccctc gtgcgctctc ctgttccgac cctgccgctt accggatacc
     tgtccgcctt tctcccttcg ggaagcgtgg cgctttctca tagctcacgc tgtaggtatc
     tcagttcggt gtaggtcgtt cgctccaagc tgggctgtgt gcacgaaccc cccgttcagc
     ccgaccgctg cgccttatcc ggtaactatc gtcttgagtc caacccggta agacacgact
     tatcgccact ggcagcagcc actggtaaca ggattagcag agcgaggtat gtaggcggtg
     ctacagagtt cttgaagtgg tggcctaact acggctacac tagaaggaca gtatttggta
     tctgcgctct gctgaagcca gttaccttcg gaaaaagagt tggtagctct tgatccggca
     aacaaaccac cgctggtagc ggtggttttt ttgtttgcaa gcagcagatt acgcgcagaa
     aaaaaggatc tcaagaagat cctttgatct tttctacggg gtctgacgct cagtggaacg
     aaaactcacg ttaagggatt ttggtcatga gattatcaaa aaggatcttc acctagatcc
     ttttaaatta aaaatgaagt tttaaatcaa tctaaagtat atatgagtaa acttggtctg
     acagttacca atgcttaatc agtgaggcac ctatctcagc gatctgtcta tttcgttcat
     ccatagttgc ctgactcccc gtcgtgtaga taactacgat acgggagggc ttaccatctg
     gccccagtgc tgcaatgata ccgcgagacc cacgctcacc ggctccagat ttatcagcaa
     taaaccagcc agccggaagg gccgagcgca gaagtggtcc tgcaacttta tccgcctcca
     tccagtctat taattgttgc cgggaagcta gagtaagtag ttcgccagtt aatagtttgc
     gcaacgttgt tgccattgct gcaggcatcg tggtgtcacg ctcgtcgttt ggtatggctt
     cattcagctc cggttcccaa cgatcaaggc gagttacatg atcccccatg ttgtgcaaaa
     aagcggttag ctccttcggt cctccgatcg ttgtcagaag taagttggcc gcagtgttat
     cactcatggt tatggcagca ctgcataatt ctcttactgt catgccatcc gtaagatgct
     tttctgtgac tggtgagtac tcaaccaagt cattctgaga atagtgtatg cggcgaccga
     gttgctcttg cccggcgtca acacgggata ataccgcgcc acatagcaga actttaaaag
     tgctcatcat tggaaaacgt tcttcggggc gaaaactctc aaggatctta ccgctgttga
     gatccagttc gatgtaaccc actcgtgcac ccaactgatc ttcagcatct tttactttca
     ccagcgtttc tgggtgagca aaaacaggaa ggcaaaatgc cgcaaaaaag ggaataaggg
     cgacacggaa atgttgaata ctcatactct tcctttttca atattattga agcatttatc
     agggttattg tctcatgagc ggatacatat ttgaatgtat ttagaaaaat aaacaaatag
     gggttccgcg cacatttccc cgaaaagtgc cacctgacgt ctaagaaacc attattatca
     tgacattaac ctataaaaat aggcgtatca cgaggccctt tcgtcttcaa gaattaattc
     ccggggatcc gtcgacctgc agatctctag aagcttctag agatcttcca tacctaccag
     ttctccgcct gcagcaatgg caacaacgtt gcccggatc
//