back Return to this vector's summary.
ID   PIAN13     preliminary; circular DNA; SYN; 894 BP.
XX
AC   ATCC37544;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector piAN13 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   EMBL3A from EMBL3
RC   piAN7 from linker & piVX & pBR322
RC   piAN13 from piAN7 & pUC13
RC   piMT5lambdaSX from piAN13 & lambda
RC   lambda R76d2 from EMBL3A & lambda cI857 Sam7 & lambda gtWES.lambdaB
RC   Syrinx 2A from EMBL3A & Charon 4A & lambda R76d2
RA   Lutz C.T., Hollifield W.C., Seed B., Davie J.M., Huang H.V.;
RT   "Syrinx 2A: an improved lambda phage vector designed for screening
RT   DNA libraries by recombination in vivo";
RL   Proc. Natl. Acad. Sci. U.S.A. 84:4379-4383(1987).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   Designed for screening DNA libraries by homologous recombination using
CC   Syrinx2A bacteriophage vector.
CC   Restriction digests of the clone give the following sizes (kb):
CC   BamHI--0.88; HindIII--0.88; EcoRI--0.88. (ATCC staff)
CC   Medium is 1227 LB plus ampicillin.
CC   NM (piAN13)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (ATCC)
CC   HO (E.coli MC1061p3)(E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (piAN7)(pUC13)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. piAN7 remove EcoRI-HindIII 36bp 204..240
FT                   \ aattcccggggatccgtcgacctgcagatctctaga, MCS/849bp
FT                   2. pUC13 HindIII-EcoRI 45bp 234..279, MCS
FT                   -> piAN13 895bp"
FT   -               1..203
FT                   /note="piAN7 1..203 203bp
FT                   EcoRI = G^AATTC"
FT   -               204..248
FT                   /note="pUC13 234..278 45bp complement
FT                   HindIII = A^AGCTT"
FT   -               249..894
FT                   /note="piAN7 240..885 646bp"
FT   misc_binding    0..0
FT                   /note="MCS EcoRI-SacI-SmaI-BamHI-XbaI-SalI-AccI-
FT                   HindII-PstI-HindIII"
FT   misc_binding    0..0
FT                   /note="SIT unique EcoRI-SacI-SmaI-BamHI-XbaI-SalI-
FT                   AccI-HindII-PstI-HindIII"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   CDS             0..0
FT                   /note="ANT E. coli kanamycin resistance gene (kan)"
FT   CDS             0..0
FT                   /note="ANT E. coli tetracycline resistance gene (tet)"
XX
SQ   Sequence 894 BP; 194 A; 245 C; 239 G; 216 T; 0 other;
     tttcggactt ttgaaagtga tggtggtggg ggaaggattc gaaccttcga agtcgatgac
     ggcagattta gagtctgctc cctttggccg ctcgggaacc ccaccacggg taatgctttt
     actggcctgc tcccttatcg ggaagcgggg cgcatcatat caaatgacgc gccgctgtaa
     agtgttacgt tgagaaagaa ttccgagctc gcccggggat cctctagagt cgacctgcag
     cccaagctgc gttgctggcg tttttccata ggctccgccc ccctgacgag catcacaaaa
     atcgacgctc aagtcagagg tggcgaaacc cgacaggact ataaagatac caggcgtttc
     cccctggaag ctccctcgtg cgctctcctg ttccgaccct gccgcttacc ggatacctgt
     ccgcctttct cccttcggga agcgtggcgc tttctcatag ctcacgctgt aggtatctca
     gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc gttcagcccg
     accgctgcgc cttatccggt aactatcgtc ttgagtccaa cccggtaaga cacgacttat
     cgccactggc agcagccact ggtaacagga ttagcagagc gaggtatgta ggcggtgcta
     cagagttctt gaagtggtgg cctaactacg gctacactag aaggacagta tttggtatct
     gcgctctgct gaagccagtt accttcggaa aaagagttgg tagctcttga tccggcaaac
     aaaccaccgc tggtagcggt ggtttttttg tttgcaagca gcagattacg cgcagaaaaa
     aaggatctca agaagatcct ttgatctttt ctacggggtc tgacgctcaa attc
//