back Return to this vector's summary.
ID   PIAN7      preliminary; circular DNA; SYN; 885 BP.
XX
AC   L08875; VB0066;
XX
DT   04-JUN-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector piAN7 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-885
RC   piAN7
RA   Gilbert W.;
RT   "Obtained from VecBase 3.0";
RL   Unpublished (1991).
XX
RN   [2]
RP   1-885
RC   piAN7
RA   ;
RT   ;
RL   Submitted (12-SEP-1986) on magnetic tape by:
RL   . ., New England Biolabs, .
XX
RN   [3]
RC   pLM1, pLM2 from Pseudomonas RP1 plasmid
RA   Mindich L., Cohen J., Weisburd M.;
RT   "Isolation of nonsense suppressor mutants in Pseudomonas";
RL   J. Bacteriol. 126:177-182(1976).
XX
RN   [4]
RC   pRD69 from tyrosine tRNA suppressor gene
RA   Dunn R.;
RT   ;
RL   Unpublished (1983).
XX
RN   [5]
RP   1-885
RC   piAN7
RA   Pfeiffer F.;
RT   ;
RL   Submitted (16-DEC-1986) by:
RL   Pfeiffer F., New England Biolabs, .
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   These data and their annotation were supplied to GenBank by Will
CC   Gilbert under the auspices of the GenBank Currator Program.
CC
CC   piAN7 is thought to replace piVX.
CC   The polylinker of piAN7 contains additional BglII and XbaI
CC   sites within the M13mp8/pUC8 polylinker.
CC   NCBI gi: 310776
CC   NM (piAN7)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (NEB)
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE (SupF)
CC   PA (pi-VX)(pBR322)(pUC8)(EcoTgy)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. piVX EcoRI-EcoRI 203bp 111..314, supF
FT                   \ EcoRI = 2 111 314
FT                   fill in:
FT                   2. linker EcoRI-HindIII 42bp
FT                   \ gaattcccggggatccgtcgacctgcagatctctagaagctt
FT                   3. pBR322 FnuDII-DdeI 637bp 2521..3158, ori
FT                   \ DdeI = 1582 1744 2284 2749 3158 3324 3864 4290
FT                   \ FnuDII = 348 704 819 948 975 980 1041 1108 1236 1246
FT                   \ 1418 1539 1636 2006 2075 2077 2180 2521 3012 3432
FT                   \ 3925 4257
FT                   HindIII linker 8bp caagcttg
FT                   HindIII-DdeI 645bp, ori
FT                   :fill in
FT                   -> piAN7 885bp [unique EcoRI in MCS]
FT                   1. piVX remove HindIII-XbaI-BglII-PstI 42bp 33..75,
FT                   \ MCS/860bp
FT                   2. pUC8 PstI-HindIII 4bp 257..261, MCS [5bp]
FT                   linker HindIII-XbaI-BglII-PstI 18bp agcttctagatctctgca
FT                   -> piAN7 885bp"
FT   -               1..203
FT                   /note="piVX 111..313 203bp
FT                   EcoRI = G^AATTC"
FT   -               204..239
FT                   /note="aattcccggggatccgtcgacctgcagatctctaga 36bp
FT                   HindIII = A^AGCTT
FT                   \           agcttg"
FT   -               240..245
FT                   /note="agcttg 6bp
FT                   \    agcttg
FT                   FnuDII = CG^CG"
FT   -               246..885
FT                   /note="pBR322 2521..3160 640bp
FT                   DdeI =  C^TNA G
FT                   EcoRI =     G^AATTC"
FT   tRNA            1..202
FT                   /note="RNA synthetic tyr-tRNA; GenBank(50):EcoTgy
FT                   SupF gene"
FT   misc_binding    198..225
FT                   /note="MCS part 1 of pUC8/M13mp8 polylinker;
FT                   EcoRI-SmaI-BamHI-SalI-PstI-BglII-XbaI-HindIII"
FT   misc_binding    234..239
FT                   /note="MCS part 2 of pUC8/M13mp8 polylinker;
FT                   EcoRI-SmaI-BamHI-SalI-PstI-BglII-XbaI-HindIII"
FT   misc_feature    240..880
FT                   /note="from pBR322"
XX
SQ   Sequence 885 BP; 193 A; 239 C; 236 G; 217 T; 0 other;
     tttcggactt ttgaaagtga tggtggtggg ggaaggattc gaaccttcga agtcgatgac
     ggcagattta gagtctgctc cctttggccg ctcgggaacc ccaccacggg taatgctttt
     actggcctgc tcccttatcg ggaagcgggg cgcatcatat caaatgacgc gccgctgtaa
     agtgttacgt tgagaaagaa ttcccgggga tccgtcgacc tgcagatctc tagaagcttg
     cgttgctggc gtttttccat aggctccgcc cccctgacga gcatcacaaa aatcgacgct
     caagtcagag gtggcgaaac ccgacaggac tataaagata ccaggcgttt ccccctggaa
     gctccctcgt gcgctctcct gttccgaccc tgccgcttac cggatacctg tccgcctttc
     tcccttcggg aagcgtggcg ctttctcata gctcacgctg taggtatctc agttcggtgt
     aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg
     ccttatccgg taactatcgt cttgagtcca acccggtaag acacgactta tcgccactgg
     cagcagccac tggtaacagg attagcagag cgaggtatgt aggcggtgct acagagttct
     tgaagtggtg gcctaactac ggctacacta gaaggacagt atttggtatc tgcgctctgc
     tgaagccagt taccttcgga aaaagagttg gtagctcttg atccggcaaa caaaccaccg
     ctggtagcgg tggttttttt gtttgcaagc agcagattac gcgcagaaaa aaaggatctc
     aagaagatcc tttgatcttt tctacggggt ctgacgctca aattc
//