back Return to this vector's summary.
ID   PIC20HE    preliminary; circular DNA; SYN; 2865 BP.
XX
AC   S52393;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pIC20HE - complete, MCS.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-153
RC   pJOE930 from pIC19H
RC   pJOE773 from pIC19H & pHP45omega & pIC20R
RC   pJOE875 from pJOE773 & pIJ350 & pIJ702, melanin
RC   pIC20HE from pIC20H & linker
RC   plasmid from pIC20HE & pIJ4083, xylE gene
RC   pJOE814.1 from plasmid & pJOE773
RA   Altenbuchner J., Viell P., Pelletier I.;
RT   "Positive selection vectors based on palindromic DNA sequences";
RL   Meth. Enzymol. 216:457-466(1992).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   MCS. oligonucleotide linker. in GenBank.
CC   NCBI gibbsq 122171
CC   NCBI gi: 263272
CC   NM (pIC20HE)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pIC20H)
CC   BR (pJOE series)
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pIC20H remove KpnI-SacI 6bp 277..283, MCS
FT                   \ may be 277..312/2716bp
FT                   blunt end:blunt end
FT                   2. linker KpnI-NcoI-ApaI-SacII-NotI/EagI-XhoI-EcoRI-
FT                   \ ClaI-SnaBI-NaeI-NheI-EcoRV-BglII-MluI-SacI 153bp
FT                   \ atgaccatgattacgccaagcttgcatgcctgcaggtcgactctagagga
FT                   \ tccccgggtaccatgggcccgcggccgcctcgagaattcatcgatacgta
FT                   \ gccggctagcgatatcagatctacgcgtacgagctcgcgaaagcttggca
FT                   \ ctg
FT                   -> pIC20HE 2869bp"
FT   -               1..272
FT                   /note="pIC20H 1..272 276bp
FT                   KpnI = GGTAC^C
FT                   \       atgac..."
FT   -               273..425
FT                   /note="153bp
FT                   \ atgaccatgattacgccaagcttgcatgcctgcaggtcgactctagagga
FT                   \ tccccgggtaccatgggcccgcggccgcctcgagaattcatcgatacgta
FT                   \ gccggctagcgatatcagatctacgcgtacgagctcgcgaaagcttggca
FT                   \ ctg
FT                   \            ...ctg
FT                   SacI = SstI = GAGCT^C"
FT   -               426..2865
FT                   /note="pIC20H 283..2722 2440bp"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 2865 BP; 700 A; 738 C; 724 G; 703 T; 0 other;
     gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca
     cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaatg tgagttagct
     cactcattag gcaccccagg ctttacactt tatgcttccg gctcgtatgt tgtgtggaat
     tgtgagcgga taacaatttc acacaggaaa cagctatgac catgattacg ccaagcttgc
     atgcctgcag gtcgactcta gaggatcccc ggatgaccat gattacgcca agcttgcatg
     cctgcaggtc gactctagag gatccccggg taccatgggc ccgcggccgc ctcgagaatt
     catcgatacg tagccggcta gcgatatcag atctacgcgt acgagctcgc gaaagcttgg
     cactgcgaat tcatcgatat ctagatctcg agctcgcgaa agcttggcac tggccgtcgt
     tttacaacgt cgtgactggg aaaaccctgg cgttacccaa cttaatcgcc ttgcagcaca
     tccccctttc gccagctggc gtaatagcga agaggcccgc accgatcgcc cttcccaaca
     gttgcgcagc ctgaatggcg aatggcgcct gatgcggtat tttctcctta cgcatctgtg
     cggtatttca caccgcatat ggtgcactct cagtacaatc tgctctgatg ccgcatagtt
     aagccagccc cgacacccgc caacacccgc tgacgcgccc tgacgggctt gtctgctccc
     ggcatccgct tacagacaag ctgtgaccgt ctccgggagc tgcatgtgtc agaggttttc
     accgtcatca ccgaaacgcg cgagacgaaa gggcctcgtg atacgcctat ttttataggt
     taatgtcatg ataataatgg tttcttagac gtcaggtggc acttttcggg gaaatgtgcg
     cggaacccct atttgtttat ttttctaaat acattcaaat atgtatccgc tcatgagaca
     ataaccctga taaatgcttc aataatattg aaaaaggaag agtatgagta ttcaacattt
     ccgtgtcgcc cttattccct tttttgcggc attttgcctt cctgtttttg ctcacccaga
     aacgctggtg aaagtaaaag atgctgaaga tcagttgggt gcacgagtgg gttacatcga
     actggatctc aacagcggta agatccttga gagttttcgc cccgaagaac gttttccaat
     gatgagcact tttaaagttc tgctatgtgg cgcggtatta tcccgtattg acgccgggca
     agagcaactc ggtcgccgca tacactattc tcagaatgac ttggttgagt actcaccagt
     cacagaaaag catcttacgg atggcatgac agtaagagaa ttatgcagtg ctgccataac
     catgagtgat aacactgcgg ccaacttact tctgacaacg atcggaggac cgaaggagct
     aaccgctttt ttgcacaaca tgggggatca tgtaactcgc cttgatcgtt gggaaccgga
     gctgaatgaa gccataccaa acgacgagcg tgacaccacg atgcctgtag caatggcaac
     aacgttgcgc aaactattaa ctggcgaact acttactcta gcttcccggc aacaattaat
     agactggatg gaggcggata aagttgcagg accacttctg cgctcggccc ttccggctgg
     ctggtttatt gctgataaat ctggagccgg tgagcgtggg tctcgcggta tcattgcagc
     actggggcca gatggtaagc cctcccgtat cgtagttatc tacacgacgg ggagtcaggc
     aactatggat gaacgaaata gacagatcgc tgagataggt gcctcactga ttaagcattg
     gtaactgtca gaccaagttt actcatatat actttagatt gatttaaaac ttcattttta
     atttaaaagg atctaggtga agatcctttt tgataatctc atgaccaaaa tcccttaacg
     tgagttttcg ttccactgag cgtcagaccc cgtagaaaag atcaaaggat cttcttgaga
     tccttttttt ctgcgcgtaa tctgctgctt gcaaacaaaa aaaccaccgc taccagcggt
     ggtttgtttg ccggatcaag agctaccaac tctttttccg aaggtaactg gcttcagcag
     agcgcagata ccaaatactg tccttctagt gtagccgtag ttaggccacc acttcaagaa
     ctctgtagca ccgcctacat acctcgctct gctaatcctg ttaccagtgg ctgctgccag
     tggcgataag tcgtgtctta ccgggttgga ctcaagacga tagttaccgg ataaggcgca
     gcggtcgggc tgaacggggg gttcgtgcac acagcccagc ttggagcgaa cgacctacac
     cgaactgaga tacctacagc gtgagctatg agaaagcgcc acgcttcccg aagggagaaa
     ggcggacagg tatccggtaa gcggcagggt cggaacagga gagcgcacga gggagcttcc
     agggggaaac gcctggtatc tttatagtcc tgtcgggttt cgccacctct gacttgagcg
     tcgatttttg tgatgctcgt caggggggcg gagcctatgg aaaaacgcca gcaacgcggc
     ctttttacgg ttcctggcct tttgctggcc ttttgctcac atgttctttc ctgcgttatc
     ccctgattct gtggataacc gtattaccgc ctttgagtga gctgataccg ctcgccgcag
     ccgaacgacc gagcgcagcg agtcagtgag cgaggaagcg gaaga
//