back Return to this vector's summary.
ID   PIC7       preliminary; circular DNA; SYN; 2668 BP.
XX
AC   L08880; VB0090; K02758; ATCC37420;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pIC7 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pIC7 from pUC8 & oligo
RC   M13mIC7 from M13mp10 & oligo
RC   pIC19R from pIC7 & pUC9
RC   pIC20R from pIC7 & pUC19
RC   pIC19H from pIC7 & pUC9
RC   pIC20H from pIC7 & pUC19
RC   pICEM19R+ from pIC7 & pEMBL8+
RC   pICEM19R- from pIC7 & pEMBL8-
RC   pICEM19H+ from pIC7 & pEMBL8+
RC   pICEM19H- from pIC7 & pEMBL8+
RA   Marsh J.L., Erfle M., Wykes E.J.;
RT   "The pIC plasmid and phage vectors with versatile cloning sites
RT   for recombinant selection by insertional inactivation";
RL   Gene 32:481-485(1984).
XX
RN   [2]
RP   1-2668
RC   pIC7
RA   Gilbert W.;
RT   "VecBase 3.0";
RL   Unpublished (1991).
XX
CC   These data and their annotation were supplied to GenBank by Will
CC   Gilbert under the auspices of the GenBank Currator Program.
CC
CC   Assembled from pUC8 and pIC7 by F. Pfeiffer
CC   For construction of pIC7, a synthetic oligonucleotide has
CC   been used to replace the pUC8 polylinker and thus to construct
CC   a new cloning vector with a different polylinker. The other
CC   pIC-vectors are based on this new pIC7 polylinker, which was
CC   combined with the existing pUC9 and pUC19 polylinkers in the
CC   following arrangements:
CC   pIC19 and pICEM19 vectors:
CC   pIC19R:   EcoRI- Poly (pIC7) -HindIII- Poly (pUC9) -EcoRI
CC   pIC19H: HindIII- Poly (pUC9) -EcoRI  - Poly (pIC7) -HindIII
CC   pIC20-vectors:
CC   pIC20R:   EcoRI- Poly (pIC7) -HindIII- Poly(pUC19) -EcoRI
CC   pIC20H: HindIII- Poly(pUC19) -EcoRI  - Poly (pIC7) -HindIII
CC
CC   To produce greater versatility of insertional inactivation of
CC   beta-galactosidase activity for subcloning and sequencing, a
CC   chemically synthesized oligonucleotide, specifying nine
CC   restriction sites including BglII, XhoI, NruI, ClaI, SacI and
CC   EcorV in various configurations with existing polylinkers, was
CC   created. These improved polylinkers were inserted into plasmids
CC   for routine cloning of ds-DNA and into chimeric phage/plasmids
CC   for biological production of ss-DNA.  The most versatile
CC   polyrecognition pattern specifies 17 restriction sites in the
CC   beta-galactosidase alpha-complementing gene fragment. Clone
CC   pIC7 was used to produce all the other polylinker-carrying
CC   vectors.
CC   A general purpose cloning vector for inserting DNA into polylinker in
CC   lacZ'.
CC   Medium is 1227 LB plus ampicillin.
CC   NM (pIC7)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (ATCC)
CC   HO (E.coli TB1)(E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pIC7)(pUC8)
CC   BR ()
CC   OF (pIC19H)(pIC19R)(pIC20H)(pIC20R)(pICEM19H-)(pICEM19H+)
CC   OF (pICEM19R-)(pICEM19R+)
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pUC8 remove EcoRI-HindIII 30bp 231..261,
FT                   \ MCS/2635bp
FT                   2. oligo EcoRI-HindIII 33bp
FT                   \ aattcatcgatatctagatctcgagctcgcgaa
FT                   -> pIC7 2668bp"
FT   misc_binding    284..322
FT                   /note="MCS EcoRI-ClaI-EcoRV-XbaI-BglII-XhoI-SacI-
FT                   NruI-HindIII; polylinker of pIC7"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             0..0
FT                   /note="GEN E. coli beta-galactosidase gene (lacZ')"
FT   CDS             934..1722
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   misc_feature    1..235
FT                   /note="from pUC8"
FT   misc_feature    263..2668
FT                   /note="from pUC8"
XX
SQ   Sequence 2668 BP; 658 A; 677 C; 668 G; 665 T; 0 other;
     gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca
     cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaatg tgagttagct
     cactcattag gcaccccagg ctttacactt tatgcttccg gctcgtatgt tgtgtggaat
     tgtgagcgga taacaatttc acacaggaaa cagctatgac catgattacg aattcatcga
     tatctagatc tcgagctcgc gaaagcttgg cactggccgt cgttttacaa cgtcgtgact
     gggaaaaccc tggcgttacc caacttaatc gccttgcagc acatccccct ttcgccagct
     ggcgtaatag cgaagaggcc cgcaccgatc gcccttccca acagttgcgc agcctgaatg
     gcgaatggcg cctgatgcgg tattttctcc ttacgcatct gtgcggtatt tcacaccgca
     tatggtgcac tctcagtaca atctgctctg atgccgcata gttaagccag ccccgacacc
     cgccaacacc cgctgacgcg ccctgacggg cttgtctgct cccggcatcc gcttacagac
     aagctgtgac cgtctccggg agctgcatgt gtcagaggtt ttcaccgtca tcaccgaaac
     gcgcgagacg aaagggcctc gtgatacgcc tatttttata ggttaatgtc atgataataa
     tggtttctta gacgtcaggt ggcacttttc ggggaaatgt gcgcggaacc cctatttgtt
     tatttttcta aatacattca aatatgtatc cgctcatgag acaataaccc tgataaatgc
     ttcaataata ttgaaaaagg aagagtatga gtattcaaca tttccgtgtc gcccttattc
     ccttttttgc ggcattttgc cttcctgttt ttgctcaccc agaaacgctg gtgaaagtaa
     aagatgctga agatcagttg ggtgcacgag tgggttacat cgaactggat ctcaacagcg
     gtaagatcct tgagagtttt cgccccgaag aacgttttcc aatgatgagc acttttaaag
     ttctgctatg tggcgcggta ttatcccgta ttgacgccgg gcaagagcaa ctcggtcgcc
     gcatacacta ttctcagaat gacttggttg agtactcacc agtcacagaa aagcatctta
     cggatggcat gacagtaaga gaattatgca gtgctgccat aaccatgagt gataacactg
     cggccaactt acttctgaca acgatcggag gaccgaagga gctaaccgct tttttgcaca
     acatggggga tcatgtaact cgccttgatc gttgggaacc ggagctgaat gaagccatac
     caaacgacga gcgtgacacc acgatgcctg tagcaatggc aacaacgttg cgcaaactat
     taactggcga actacttact ctagcttccc ggcaacaatt aatagactgg atggaggcgg
     ataaagttgc aggaccactt ctgcgctcgg cccttccggc tggctggttt attgctgata
     aatctggagc cggtgagcgt gggtctcgcg gtatcattgc agcactgggg ccagatggta
     agccctcccg tatcgtagtt atctacacga cggggagtca ggcaactatg gatgaacgaa
     atagacagat cgctgagata ggtgcctcac tgattaagca ttggtaactg tcagaccaag
     tttactcata tatactttag attgatttaa aacttcattt ttaatttaaa aggatctagg
     tgaagatcct ttttgataat ctcatgacca aaatccctta acgtgagttt tcgttccact
     gagcgtcaga ccccgtagaa aagatcaaag gatcttcttg agatcctttt tttctgcgcg
     taatctgctg cttgcaaaca aaaaaaccac cgctaccagc ggtggtttgt ttgccggatc
     aagagctacc aactcttttt ccgaaggtaa ctggcttcag cagagcgcag ataccaaata
     ctgtccttct agtgtagccg tagttaggcc accacttcaa gaactctgta gcaccgccta
     catacctcgc tctgctaatc ctgttaccag tggctgctgc cagtggcgat aagtcgtgtc
     ttaccgggtt ggactcaaga cgatagttac cggataaggc gcagcggtcg ggctgaacgg
     ggggttcgtg cacacagccc agcttggagc gaacgaccta caccgaactg agatacctac
     agcgtgagct atgagaaagc gccacgcttc ccgaagggag aaaggcggac aggtatccgg
     taagcggcag ggtcggaaca ggagagcgca cgagggagct tccaggggga aacgcctggt
     atctttatag tcctgtcggg tttcgccacc tctgacttga gcgtcgattt ttgtgatgct
     cgtcaggggg gcggagccta tggaaaaacg ccagcaacgc ggccttttta cggttcctgg
     ccttttgctg gccttttgct cacatgttct ttcctgcgtt atcccctgat tctgtggata
     accgtattac cgcctttgag tgagctgata ccgctcgccg cagccgaacg accgagcgca
     gcgagtcagt gagcgaggaa gcggaaga
//