back Return to this vector's summary.
ID   PJFCAT1    preliminary; circular DNA; SYN; 5603 BP.
XX
AC   ATCC77317;
XX
DT   03-FEB-1994 (Rel. 8, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Vertebrate/E.coli phagemid vector pJFCAT1 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pBLCAT3.f1 from pBLCAT3 & pUC-f1
RC   pUC.A.1.5 from pUC18
RC   pJFCAT1 from pBLCAT3.f1 & pUC.A.1.5
RC   pGEM2-human-beta-globin from pGEM-2 & human beta-globin gene
RC   pbetaGloXH from pGEM-7 series & pGEM2-human-beta-globin
RC   pbetaGlo4 from pbetaGloXH & mouse tk promoter
RC   pbetaGlo4pA from pbetaGlo4 & pJFCAT1
RC   pTAG-1 from pbetaGlo4pA & pBLCAT3
RA   Fridovich-Keil J.L., Gudas J.M., Bryan I.B., Pardee A.B.;
RT   "Improved expression vectors for eukaryotic promoter/enhancer
RT   studies";
RL   Biotechniques 11:572-579(1991).
XX
RN   [2]
RC   pUC18.Bgl.Hind from pUC18.Bgl & linker
RC   pUC18.Bgl.SVA from pUC18.Bgl & pTH1, SV40 polyA
RC   pUC.A.1.5 from pUC18.Bgl.SVA & pUC18.Bgl.Hind
RA   Maxwell L.H., Harrison G.S., Wood W.M., Maxwell F.;
RT   "A DNA cassette containing a trimerized SV40 polyadenylation
RT   signal which efficiently blocks spurious plasmid-initiated
RT   transcription";
RL   Biotechniques 7:276-280(1989).
XX
RN   [3]
RC   pUC18.Bgl from pUC18 & linker
RA   Palmiter R.;
RT   ;
RL   Unpublished (1989).
XX
RN   [4]
RC   pTH1 from SV40 polyA
RA   Maxwell L.H., Maxwell F., Glode L.M.;
RT   "Regulated expression of a diphteria toxin A-chain gene transfected
RT   into human cells: possible strategy for inducing cancer cell suicide";
RL   Cancer Res. 46:4660-4664(1986).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   Deposited by: Judith L. Fridovich-Keil
CC   A promoter/enhancer-cloning shuttle vector using chloramphenicol
CC   acetyltransferase (CAT) as the reporter gene. [1]
CC   Promoter elements cloned into the polylinker may be sequenced using
CC   the following oligonucleotide primers:
CC   primer 1:  5'-TCCTTAGCTCCTGAAAATCT-3';
CC   primer 2:  5'-AAACTCATCAATGTATCTTA- 3'. [1]
CC   Contains a trimer cassette of the SV40 major late polyadenylation
CC   signal to block background readthrough expression of the reporter
CC   gene. [1]
CC   The order of the major features in this phagemid is :  HindIII - SV40
CC   polyadenylation trimer - primer 2 site - BamHI/MCS/XhoI - primer 1
CC   site - CAT gene - SV40 splice and polyadenylation signal - f1 ori -
CC   KpnI - SstI - ampR/pUC18. [1]
CC   The KpnI and SstI sites can be used for cloning enhancer elements. [1]
CC   Restriction digests of the clone give the following sizes (kb):
CC   HindIII--5.0, 0.75; EcoRI/HindIII--2.7, 2.0, 0.75, 0.3; XhoI--5.8.
CC   (ATCC staff)
CC   To avoid potential problems using primer 2, try the following primer
CC   sequence instead (assumes promoter inserted at or downstream of the
CC   SphI site):  5' TTATCATGTCTGGATCCAAG 3' (personal communication)
CC   Medium is 1227 LB plus ampicillin.
CC   NM (pJFCAT1)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (phagemid)
CC   SP (ATCC)
CC   HO (E.coli)(E.coli HB101)(vertebrate cells)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pBLCAT3)(pUC18)(SV40)
CC   BR ()
CC   OF (pTAG-1)
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pUC18 remove HindIII-XbaI 24bp 400..424,
FT                   \ MCS/2662bp
FT                   2. BglII linker 6bp agatct
FT                   -> pUC18.Bgl 2662bp
FT                   1. pUC18.Bgl EcoRI 2662bp 451..451
FT                   fill in
FT                   2. HindIII linker 6bp aagctt
FT                   -> pUC18.Bgl.Hind 2662bp
FT                   1. SV40 BamHI-BclI 237bp 2534..2771, early/late polyA
FT                   -> pTH1
FT                   1. pUC18.Bgl BamHI 2662bp 430..430
FT                   2. pTH1 Sau3A1/MboI-Sau3A1/MboI 237bp 2534..2771,
FT                   \ SV40 early polyA/late polyA
FT                   \ Sau3AI/MboI = 874 2138 2534 2771 3716 4100 4700 4710
FT                   \ 4770
FT                   BamHI-BclI 237bp 2534..2771, SV40 early/late polyA
FT                   -> pUC18.Bgl.SVA 2900bp [BglII then BamHI]
FT                   1. pUC18.Bgl.SVA BglII-BamHI 254bp 424..-..430,
FT                   \ [254bp]
FT                   self-ligation to make trimer
FT                   BglII-BamHI 729bp, SV40 early/late polyA trimer
FT                   2. pUC18.Bgl.Hind BamHI 2662bp 430..430
FT                   -> pUC.A.1.5 2900bp [BglII then BamHI]
FT                   1. pBLCAT3 remove SmaI-KpnI 6bp 2095..2101, 4338bp
FT                   2. pUC-f1 KpnI-BamHI 519bp 413..932, phage f1 ori
FT                   :Klenow
FT                   -> pBLCAT3.f1 4857bp
FT                   1. pBLCAT3.f1 HindIII 4857bp 962..962
FT                   2. pUC.A.1.5 BamHI-BglII 729bp, SV40 late polyA trimer
FT                   Klenow:Klenow
FT                   HindIII linker 6bp aagctt:HindIII linker 6bp aagctt
FT                   HindIII-HindIII
FT                   -> pJFCAT1 5586bp [5500bp]"
FT   -               1..961
FT                   /note="pBLCAT3 1..961 961bp
FT                   HindIII = A^AGCTT
FT                   \           agctt"
FT   -               962..966
FT                   /note="agctt 5bp
FT                   \   agctt
FT                   BamHI = G^GATCC"
FT   -               967..1203
FT                   /note="SV40 2534..2770 237bp
FT                   BclI =  T^GATCA
FT                   BglII = A^GATCT"
FT   -               1204..1210
FT                   /note="pUC18 424..430 7bp
FT                   BamHI = G^GATCC"
FT   -               1211..1447
FT                   /note="SV40 2534..2770 237bp
FT                   BclI =  T^GATCA
FT                   BglII = A^GATCT"
FT   -               1448..1454
FT                   /note="pUC18 424..430 7bp
FT                   BamHI = G^GATCC"
FT   -               1455..1691
FT                   /note="SV40 2534..2770 237bp
FT                   BclI =  T^GATCA
FT                   BglII = A^GATCT"
FT   -               1692..1698
FT                   /note="pUC18 424..430 7bp
FT                   BamHI = G^GATC C
FT                   BglII = A^GATC T
FT                   HindIII =      A^AGCTT
FT                   \              a"
FT   -               1699..1699
FT                   /note="a 1bp
FT                   \         a
FT                   HindIII = A^AGCTT"
FT   -               1700..2832
FT                   /note="pBLCAT3 962..2094 1133bp
FT                   SmaI = CCC^GGG
FT                   BamHI =  G^GATCC"
FT   -               2833..3359
FT                   /note="pUC-f1 409..935 527bp complement
FT                   KpnI = GGTAC^C"
FT   -               3360..5603
FT                   /note="pBLCAT3 2101..4344 2244bp"
FT   misc_binding    0..0
FT                   /note="SIT HindIII"
FT   polyA_signal    0..0
FT                   /note="PLA SV40 major late gene trimer"
FT   misc_binding    0..0
FT                   /note="MCS BamHI-HindIII-SphI-PstI-SalI-BamHI-BglII-
FT                   XhoI"
FT   misc_binding    0..0
FT                   /note="SIT unique SphI-PstI-SalI-BglII-XhoI"
FT   CDS             0..0
FT                   /note="ANT E. coli chloramphenicol acetyltransferase
FT                   gene (cat); chloramphenicol resistance gene (cmr/cml),
FT                   from pBLCAT3"
FT   misc_binding    0..0
FT                   /note="SIT EcoRI"
FT   polyA_signal    0..0
FT                   /note="PLA SV40 early gene, from pBLCAT3"
FT   misc_feature    0..0
FT                   /note="SV40 small T intron splice site, from pBLCAT3"
FT   rep_origin      0..0
FT                   /note="ORI bacteriophage f1"
FT   misc_binding    0..0
FT                   /note="SIT unique KpnI"
FT   misc_feature    0..0
FT                   /note="from pBLCAT3 KpnI-SmaI"
FT   misc_binding    0..0
FT                   /note="SIT unique SstI"
FT   misc_binding    0..0
FT                   /note="SIT EcoRI"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp), from pBLCAT3"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322),
FT                   from pBLCAT3"
XX
SQ   Sequence 5603 BP; 1520 A; 1225 C; 1292 G; 1566 T; 0 other;
     tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca
     cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg
     ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc
     accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc
     attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat
     tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt
     tttcccagtc acgacgttgt aaaacgacgg ccagtgccaa gcttgcatgc ctgcaggtcg
     actctagagg atccagatct ggatctcgag gagcttggcg agattttcag gagctaagga
     agctaaaatg gagaaaaaaa tcactggata taccaccgtt gatatatccc aatggcatcg
     taaagaacat tttgaggcat ttcagtcagt tgctcaatgt acctataacc agaccgttca
     gctggatatt acggcctttt taaagaccgt aaagaaaaat aagcacaagt tttatccggc
     ctttattcac attcttgccc gcctgatgaa tgctcatccg gaattccgta tggcaatgaa
     agacggtgag ctggtgatat gggatagtgt tcacccttgt tacaccgttt tccatgagca
     aactgaaacg ttttcatcgc tctggagtga ataccacgac gatttccggc agtttctaca
     catatattcg caagatgtgg cgtgttacgg tgaaaacctg gcctatttcc ctaaagggtt
     tattgagaat atgtttttcg tctcagccaa tccctgggtg agtttcacca gttttgattt
     aagcttgatc cagacatgat aagatacatt gatgagtttg gacaaaccac aactagaatg
     cagtgaaaaa aatgctttat ttgtgaaatt tgtgatgcta ttgctttatt tgtaaccatt
     ataagctgca ataaacaagt taacaacaac aattgcattc attttatgtt tcaggttcag
     ggggaggtgt gggaggtttt ttaaagcaag taaaacctct acaaatgtgg tatggctgat
     tatctagagg gatccagaca tgataagata cattgatgag tttggacaaa ccacaactag
     aatgcagtga aaaaaatgct ttatttgtga aatttgtgat gctattgctt tatttgtaac
     cattataagc tgcaataaac aagttaacaa caacaattgc attcatttta tgtttcaggt
     tcagggggag gtgtgggagg ttttttaaag caagtaaaac ctctacaaat gtggtatggc
     tgattatcta gagggatcca gacatgataa gatacattga tgagtttgga caaaccacaa
     ctagaatgca gtgaaaaaaa tgctttattt gtgaaatttg tgatgctatt gctttatttg
     taaccattat aagctgcaat aaacaagtta acaacaacaa ttgcattcat tttatgtttc
     aggttcaggg ggaggtgtgg gaggtttttt aaagcaagta aaacctctac aaatgtggta
     tggctgatta tctagaggaa acgtggccaa tatggacaac ttcttcgccc ccgttttcac
     catgggcaaa tattatacgc aaggcgacaa ggtgctgatg ccgctggcga ttcaggttca
     tcatgccgtc tgtgatggct tccatgtcgg cagaatgctt aatgaattac aacagtactg
     cgatgagtgg cagggcgggg cgtaattttt ttaaggcagt tattggtgcc cttaaacgcc
     tggtgctacg cctgaataag tgataataag cggatgaatg gcagaaattc gccggatctt
     tgtgaaggaa ccttacttct gtggtgtgac ataattggac aaactaccta cagagattta
     aagctctaag gtaaatataa aatttttaag tgtataatgt gttaaactac tgattctaat
     tgtttgtgta ttttagattc caacctatgg aactgatgaa tgggagcagt ggtggaatgc
     ctttaatgag gaaaacctgt tttgctcaga agaaatgcca tctagtgatg atgaggctac
     tgctgactct caacattcta ctcctccaaa aaagaagaga aaggtagaag accccaagga
     ctttccttca gaattgctaa gttttttgag tcatgctgtg tttagtaata gaactcttgc
     ttgctttgct atttacacca caaaggaaaa agctgcactg ctatacaaga aaattatgga
     aaaatattct gtaaccttta taagtaggca taacagttat aatcataaca tactgttttt
     tcttactcca cacaggcata gagtgtctgc tattaataac tatgctcaaa aattgtgtac
     ctttagcttt ttaatttgta aaggggttaa taaggaatat ttgatgtata gtgccttgac
     tagagatcat aatcagccat accacatttg tagaggtttt acttgcttta aaaaacctcc
     cacacctccc cctgaacctg aaacataaaa tgaatgcaat tgttgttgtt aacttgttta
     ttgcagctta taatggttac aaataaagca atagcatcac aaatttcaca aataaagcat
     ttttttcact gcattctagt tgtggtttgt ccaaactcat caatgtatct tatcatgtct
     ggatcgatcc ccgatcccca cgcgccctgt agcggcgcat taagcgcggc gggtgtggtg
     gttacgcgca gcgtgaccgc tacacttgcc agcgccctag cgcccgctcc tttcgctttc
     ttcccttcct ttctcgccac gttcgccggc tttccccgtc aagctctaaa tcggggcatc
     cctttagggt tccgatttag tgctttacgg cacctcgacc ccaaaaaact tgattagggt
     gatggttcac gtagtgggcc atcgccctga tagacggttt ttcgcccttt gacgttggag
     tccacgttct ttaatagtgg actcttgttc caaactggaa caacactcaa ccctatctcg
     gtctattctt ttgatttata agggattttg ccgatttcgg cctattggtt aaaaaatgag
     ctgatttaac aaaaatttaa cgcgaatttt aacaaaatat taacgtttac aatttaaata
     tttgcttata caatcttcct gtttttgggg cttttctgat tatcaaccgg ggtgggtacc
     gagctcgaat tcgtaatcat ggtcatagct gtttcctgtg tgaaattgtt atccgctcac
     aattccacac aacatacgag ccggaagcat aaagtgtaaa gcctggggtg cctaatgagt
     gagctaactc acattaattg cgttgcgctc actgcccgct ttccagtcgg gaaacctgtc
     gtgccagctg cattaatgaa tcggccaacg cgcggggaga ggcggtttgc gtattgggcg
     ctcttccgct tcctcgctca ctgactcgct gcgctcggtc gttcggctgc ggcgagcggt
     atcagctcac tcaaaggcgg taatacggtt atccacagaa tcaggggata acgcaggaaa
     gaacatgtga gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg cgttgctggc
     gtttttccat aggctccgcc cccctgacga gcatcacaaa aatcgacgct caagtcagag
     gtggcgaaac ccgacaggac tataaagata ccaggcgttt ccccctggaa gctccctcgt
     gcgctctcct gttccgaccc tgccgcttac cggatacctg tccgcctttc tcccttcggg
     aagcgtggcg ctttctcaat gctcacgctg taggtatctc agttcggtgt aggtcgttcg
     ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg ccttatccgg
     taactatcgt cttgagtcca acccggtaag acacgactta tcgccactgg cagcagccac
     tggtaacagg attagcagag cgaggtatgt aggcggtgct acagagttct tgaagtggtg
     gcctaactac ggctacacta gaaggacagt atttggtatc tgcgctctgc tgaagccagt
     taccttcgga aaaagagttg gtagctcttg atccggcaaa caaaccaccg ctggtagcgg
     tggttttttt gtttgcaagc agcagattac gcgcagaaaa aaaggatctc aagaagatcc
     tttgatcttt tctacggggt ctgacgctca gtggaacgaa aactcacgtt aagggatttt
     ggtcatgaga ttatcaaaaa ggatcttcac ctagatcctt ttaaattaaa aatgaagttt
     taaatcaatc taaagtatat atgagtaaac ttggtctgac agttaccaat gcttaatcag
     tgaggcacct atctcagcga tctgtctatt tcgttcatcc atagttgcct gactccccgt
     cgtgtagata actacgatac gggagggctt accatctggc cccagtgctg caatgatacc
     gcgagaccca cgctcaccgg ctccagattt atcagcaata aaccagccag ccggaagggc
     cgagcgcaga agtggtcctg caactttatc cgcctccatc cagtctatta attgttgccg
     ggaagctaga gtaagtagtt cgccagttaa tagtttgcgc aacgttgttg ccattgctac
     aggcatcgtg gtgtcacgct cgtcgtttgg tatggcttca ttcagctccg gttcccaacg
     atcaaggcga gttacatgat cccccatgtt gtgcaaaaaa gcggttagct ccttcggtcc
     tccgatcgtt gtcagaagta agttggccgc agtgttatca ctcatggtta tggcagcact
     gcataattct cttactgtca tgccatccgt aagatgcttt tctgtgactg gtgagtactc
     aaccaagtca ttctgagaat agtgtatgcg gcgaccgagt tgctcttgcc cggcgtcaat
     acgggataat accgcgccac atagcagaac tttaaaagtg ctcatcattg gaaaacgttc
     ttcggggcga aaactctcaa ggatcttacc gctgttgaga tccagttcga tgtaacccac
     tcgtgcaccc aactgatctt cagcatcttt tactttcacc agcgtttctg ggtgagcaaa
     aacaggaagg caaaatgccg caaaaaaggg aataagggcg acacggaaat gttgaatact
     catactcttc ctttttcaat attattgaag catttatcag ggttattgtc tcatgagcgg
     atacatattt gaatgtattt agaaaaataa acaaataggg gttccgcgca catttccccg
     aaaagtgcca cctgacgtct aagaaaccat tattatcatg acattaacct ataaaaatag
     gcgtatcacg aggccctttc gtc
//