back Return to this vector's summary.
ID   PJP1        preliminary; circular DNA; SYN; 4390 BP.
XX
AC   IG8064;
XX
DT   01-DEC-1994 (Rel. 10, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pJP1 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pJP1 from pBR322 & synthetic phage T5 early gene promoter
RA   Rommens J., MacKnight D., Pomeroy-Cloney L., Jay E.;
RT   "Gene expression: chemical synthesis and molecular cloning of a
RT   bacteriophage T5 (T5P25) early promoter";
RL   Nucleic Acids Res. 11:5921-5940(1983).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   NM (pJP1)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN ()
CC   SE ()
CC   PA (pBR322)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 remove EcoRI-HindIII 31bp
FT                   \ 4360..4361..30, tet promoter/4330bp
FT                   2. oligo EcoRI-HindIII 60bp
FT                   \ aattcaaaaatttatttgctttcaggaaaatttttctgtataatagattc
FT                   \ ataaatttga, phage T5 early gene promoter
FT                   -> pJP1 4390bp"
FT   -               1..4330
FT                   /note="pBR322 30..4359 4330bp
FT                   EcoRI = G^AATTC
FT                   \         aattc..."
FT   -               4331..4390
FT                   /note="60bp
FT                   \ aattcaaaaatttatttgctttcaggaaaatttttctgtataatagattc
FT                   \ ataaatttga
FT                   \  ...tttga
FT                   HindIII = A^AGCTT"
FT   rep_origin      complement(0..0)
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 4390 BP; 997 A; 1209 C; 1136 G; 1048 T; 0 other;
     agctttaatg cggtagttta tcacagttaa attgctaacg cagtcaggca ccgtgtatga
     aatctaacaa tgcgctcatc gtcatcctcg gcaccgtcac cctggatgct gtaggcatag
     gcttggttat gccggtactg ccgggcctct tgcgggatat cgtccattcc gacagcatcg
     ccagtcacta tggcgtgctg ctagcgctat atgcgttgat gcaatttcta tgcgcacccg
     ttctcggagc actgtccgac cgctttggcc gccgcccagt cctgctcgct tcgctacttg
     gagccactat cgactacgcg atcatggcga ccacacccgt cctgtggatc ctctacgccg
     gacgcatcgt ggccggcatc accggcgcca caggtgcggt tgctggcgcc tatatcgccg
     acatcaccga tggggaagat cgggctcgcc acttcgggct catgagcgct tgtttcggcg
     tgggtatggt ggcaggcccc gtggccgggg gactgttggg cgccatctcc ttgcatgcac
     cattccttgc ggcggcggtg ctcaacggcc tcaacctact actgggctgc ttcctaatgc
     aggagtcgca taagggagag cgtcgaccga tgcccttgag agccttcaac ccagtcagct
     ccttccggtg ggcgcggggc atgactatcg tcgccgcact tatgactgtc ttctttatca
     tgcaactcgt aggacaggtg ccggcagcgc tctgggtcat tttcggcgag gaccgctttc
     gctggagcgc gacgatgatc ggcctgtcgc ttgcggtatt cggaatcttg cacgccctcg
     ctcaagcctt cgtcactggt cccgccacca aacgtttcgg cgagaagcag gccattatcg
     ccggcatggc ggccgacgcg ctgggctacg tcttgctggc gttcgcgacg cgaggctgga
     tggccttccc cattatgatt cttctcgctt ccggcggcat cgggatgccc gcgttgcagg
     ccatgctgtc caggcaggta gatgacgacc atcagggaca gcttcaagga tcgctcgcgg
     ctcttaccag cctaacttcg atcactggac cgctgatcgt cacggcgatt tatgccgcct
     cggcgagcac atggaacggg ttggcatgga ttgtaggcgc cgccctatac cttgtctgcc
     tccccgcgtt gcgtcgcggt gcatggagcc gggccacctc gacctgaatg gaagccggcg
     gcacctcgct aacggattca ccactccaag aattggagcc aatcaattct tgcggagaac
     tgtgaatgcg caaaccaacc cttggcagaa catatccatc gcgtccgcca tctccagcag
     ccgcacgcgg cgcatctcgg gcagcgttgg gtcctggcca cgggtgcgca tgatcgtgct
     cctgtcgttg aggacccggc taggctggcg gggttgcctt actggttagc agaatgaatc
     accgatacgc gagcgaacgt gaagcgactg ctgctgcaaa acgtctgcga cctgagcaac
     aacatgaatg gtcttcggtt tccgtgtttc gtaaagtctg gaaacgcgga agtcagcgcc
     ctgcaccatt atgttccgga tctgcatcgc aggatgctgc tggctaccct gtggaacacc
     tacatctgta ttaacgaagc gctggcattg accctgagtg atttttctct ggtcccgccg
     catccatacc gccagttgtt taccctcaca acgttccagt aaccgggcat gttcatcatc
     agtaacccgt atcgtgagca tcctctctcg tttcatcggt atcattaccc ccatgaacag
     aaatccccct tacacggagg catcagtgac caaacaggaa aaaaccgccc ttaacatggc
     ccgctttatc agaagccaga cattaacgct tctggagaaa ctcaacgagc tggacgcgga
     tgaacaggca gacatctgtg aatcgcttca cgaccacgct gatgagcttt accgcagctg
     cctcgcgcgt ttcggtgatg acggtgaaaa cctctgacac atgcagctcc cggagacggt
     cacagcttgt ctgtaagcgg atgccgggag cagacaagcc cgtcagggcg cgtcagcggg
     tgttggcggg tgtcggggcg cagccatgac ccagtcacgt agcgatagcg gagtgtatac
     tggcttaact atgcggcatc agagcagatt gtactgagag tgcaccatat gcggtgtgaa
     ataccgcaca gatgcgtaag gagaaaatac cgcatcaggc gctcttccgc ttcctcgctc
     actgactcgc tgcgctcggt cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg
     gtaatacggt tatccacaga atcaggggat aacgcaggaa agaacatgtg agcaaaaggc
     cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca taggctccgc
     ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga
     ctataaagat accaggcgtt tccccctgga agctccctcg tgcgctctcc tgttccgacc
     ctgccgctta ccggatacct gtccgccttt ctcccttcgg gaagcgtggc gctttctcat
     agctcacgct gtaggtatct cagttcggtg taggtcgttc gctccaagct gggctgtgtg
     cacgaacccc ccgttcagcc cgaccgctgc gccttatccg gtaactatcg tcttgagtcc
     aacccggtaa gacacgactt atcgccactg gcagcagcca ctggtaacag gattagcaga
     gcgaggtatg taggcggtgc tacagagttc ttgaagtggt ggcctaacta cggctacact
     agaaggacag tatttggtat ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt
     ggtagctctt gatccggcaa acaaaccacc gctggtagcg gtggtttttt tgtttgcaag
     cagcagatta cgcgcagaaa aaaaggatct caagaagatc ctttgatctt ttctacgggg
     tctgacgctc agtggaacga aaactcacgt taagggattt tggtcatgag attatcaaaa
     aggatcttca cctagatcct tttaaattaa aaatgaagtt ttaaatcaat ctaaagtata
     tatgagtaaa cttggtctga cagttaccaa tgcttaatca gtgaggcacc tatctcagcg
     atctgtctat ttcgttcatc catagttgcc tgactccccg tcgtgtagat aactacgata
     cgggagggct taccatctgg ccccagtgct gcaatgatac cgcgagaccc acgctcaccg
     gctccagatt tatcagcaat aaaccagcca gccggaaggg ccgagcgcag aagtggtcct
     gcaactttat ccgcctccat ccagtctatt aattgttgcc gggaagctag agtaagtagt
     tcgccagtta atagtttgcg caacgttgtt gccattgctg caggcatcgt ggtgtcacgc
     tcgtcgtttg gtatggcttc attcagctcc ggttcccaac gatcaaggcg agttacatga
     tcccccatgt tgtgcaaaaa agcggttagc tccttcggtc ctccgatcgt tgtcagaagt
     aagttggccg cagtgttatc actcatggtt atggcagcac tgcataattc tcttactgtc
     atgccatccg taagatgctt ttctgtgact ggtgagtact caaccaagtc attctgagaa
     tagtgtatgc ggcgaccgag ttgctcttgc ccggcgtcaa cacgggataa taccgcgcca
     catagcagaa ctttaaaagt gctcatcatt ggaaaacgtt cttcggggcg aaaactctca
     aggatcttac cgctgttgag atccagttcg atgtaaccca ctcgtgcacc caactgatct
     tcagcatctt ttactttcac cagcgtttct gggtgagcaa aaacaggaag gcaaaatgcc
     gcaaaaaagg gaataagggc gacacggaaa tgttgaatac tcatactctt cctttttcaa
     tattattgaa gcatttatca gggttattgt ctcatgagcg gatacatatt tgaatgtatt
     tagaaaaata aacaaatagg ggttccgcgc acatttcccc gaaaagtgcc acctgacgtc
     taagaaacca ttattatcat gacattaacc tataaaaata ggcgtatcac gaggcccttt
     cgtcttcaag aattcaaaaa tttatttgct ttcaggaaaa tttttctgta taatagattc
     ataaatttga
//