back Return to this vector's summary.
ID   PJQ254     preliminary; circular DNA; SYN; 2672 BP.
XX
AC   IG6002;
XX
DT   02-NOV-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pJQ254 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pACYC184-Gm from pACYC184 & pPH1JI, gentamycin
RC   pJQ51.2 from pACYC184-Gm
RC   pJQ184 from pJQ51.2 & pHP45
RC   pEM5 from RP4, traJ & oriT & mob
RC   pJQ185 from pBluescript II KS & pEM5
RC   pJQ188 from pJQ185 & pUM24, sacB gene
RC   pJQ199 from pJQ184 & pJQ188
RC   pJQ200 from pJQ199
RC   pJQ210 from pJQ199 & pHC79, lambda cos
RC   pJQ254 from pK18 & oligo
RA   Quandt J., Hynes M.F.;
RT   "Versatile suicide vectors which allow direct selection for gene
RT   replacement in gram-negative bacteria";
RL   Gene 127:15-21(1993).
XX
RN   [2]
RC   pJR23 from pUC19 & pUCD800
RC   pJR24 from pJR23
RC   pUM24 from pUC4K & pJR24
RC   pJR37 from pUM24 & pCSR1
RC   pJR38 from pJR37
RA   Ried J.L., Collmer A.;
RT   "An nptI-sacB-sacR cartridge for constructing directed, unmarked
RT   mutations in Gram-negative bacteria by marker exchange-eviction
RT   mutagenesis";
RL   Gene 57:239-246(1987).
XX
RN   [3]
RC   pCSR1 from E.chrysanthemi pelC gene
RA   Collmer A., Schoedel C., Roeder D.L., Ried J.L., Rissler J.F.;
RT   "Molecular cloning in Escherichia coli or Erwinia chrysanthemi genes
RT   encoding multiple forms of pectate lyase";
RL   J. Bacteriol. 161:913-920(1985).
XX
RN   [4]
RC   pUCD800 from B.subtilis sab gene & sacR gene
RA   Gay P., Le Coq D., Steinmetz M., Berkelman T., Kado C.I.;
RT   "Positive selection procedure for entrapment of insertion sequence
RT   elements in Gram-negative bacteria";
RL   J. Bacteriol. 164:918-921(1985).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   NM (pJQ254)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pK18)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pK18 BglII 2661bp 330..330
FT                   Klenow
FT                   remove small EcoRI-HindIII 51bp 2444..2495, 2610bp
FT                   2. oligo NotI-SmaI-NotI 54bp
FT                   \ atgaccatgattacgaattgcggccgcccgggcggccgcagtttggcact
FT                   \ ggcc
FT                   -> pJQ254 2664bp"
FT   -               1..333
FT                   /note="pK18 1..333 333bp
FT                   BglII = A^GATC T
FT                   BglII =      A^GATCT"
FT   -               334..2451
FT                   /note="pK18 330..2447 2118bp
FT                   EcoRI = G^AATT C
FT                   \              atgacc..."
FT   -               2452..2505
FT                   /note="54bp
FT                   \ atgaccatgattacgaattgcggccgcccgggcggccgcagtttggcact
FT                   \ ggcc
FT                   \ ...ctggcc
FT                   HindIII = A^AGCTT"
FT   -               2506..2672
FT                   /note="pK18 2495..2661 167bp"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 2672 BP; 585 A; 727 C; 773 G; 587 T; 0 other;
     cgataagcta gcttcacgct gccgcaagca ctcagggcgc aagggctgct aaaggaagcg
     gaacacgtag aaagccagtc cgcagaaacg gtgctgaccc cggatgaatg tcagctactg
     ggctatctgg acaagggaaa acgcaagcgc aaagagaaag caggtagctt gcagtgggct
     tacatggcga tagctagact gggcggtttt atggacagca agcgaaccgg aattgccagc
     tggggcgccc tctggtaagg ttgggaagcc ctgcaaagta aactggatgg ctttcttgcc
     gccaaggatc tgatggcgca ggggatcaag atcgatctga tcaagagaca ggatgaggat
     cgtttcgcat gattgaacaa gatggattgc acgcaggttc tccggccgct tgggtggaga
     ggctattcgg ctatgactgg gcacaacaga caatcggctg ctctgatgcc gccgtgttcc
     ggctgtcagc gcaggggcgc ccggttcttt ttgtcaagac cgacctgtcc ggtgccctga
     atgaactcca agacgaggca gcgcggctat cgtggctggc cacgacgggc gttccttgcg
     cagctgtgct cgacgttgtc actgaagcgg gaagggactg gctgctattg ggcgaagtgc
     cggggcagga tctcctgtca tctcaccttg ctcctgccga gaaagtatcc atcatggctg
     atgcaatgcg gcggctgcat acgcttgatc cggctacctg cccattcgac caccaagcga
     aacatcgcat cgagcgagca cgtactcgga tggaagccgg tcttgtcgat caggatgatc
     tggacgaaga gcatcagggg ctcgcgccag ccgaactgtt cgccaggctc aaggcgcgga
     tgcccgacgg cgaggatctc gtcgtgaccc atggcgatgc ctgcttgccg aatatcatgg
     tggaaaatgg ccgcttttct ggattcatcg actgtggccg gctgggtgtg gcggaccgct
     atcaggacat agcgttggct acccgtgata ttgctgaaga gcttggcggc gaatgggctg
     accgcttcct cgtgctttac ggtatcgccg ctcccgattc gcagcgcatc gccttctatc
     gccttcttga cgagttcttc tgagcgggac tctggggttc gaaatgaccg accaagcgac
     gcccaacctg ccatcacgag atttcgattc caccgccgcc ttctatgaaa ggttgggctt
     cggaatcgtt ttccgggacg ccggctggat gatcctccag cgcggggatc tcatgctgga
     gttcttcgcc caccccaaaa ggatctaggt gaagatcctt tttgataatc tcatgaccaa
     aatcccttaa cgtgagtttt cgttccactg agcgtcagac cccgtagaaa agatcaaagg
     atcttcttga gatccttttt ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc
     gctaccagcg gtggtttgtt tgccggatca agagctacca actctttttc cgaaggtaac
     tggcttcagc agagcgcaga taccaaatac tgtccttcta gtgtagccgt agttaggcca
     ccacttcaag aactctgtag caccgcctac atacctcgct ctgctaatcc tgttaccagt
     ggctgctgcc agtggcgata agtcgtgtct taccgggttg gactcaagac gatagttacc
     ggataaggcg cagcggtcgg gctgaacggg gggttcgtgc acacagccca gcttggagcg
     aacgacctac accgaactga gatacctaca gcgtgagcat tgagaaagcg ccacgcttcc
     cgaagggaga aaggcggaca ggtatccggt aagcggcagg gtcggaacag gagagcgcac
     gagggagctt ccagggggaa acgcctggta tctttatagt cctgtcgggt ttcgccacct
     ctgacttgag cgtcgatttt tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc
     cagcaacgcg gcctttttac ggttcctggc cttttgctgg ccttttgctc acatgttctt
     tcctgcgtta tcccctgatt ctgtggataa ccgtattacc gcctttgagt gagctgatac
     cgctcgccgc agccgaacga ccgagcgcag cgagtcagtg agcgaggaag cggaagagcg
     cccaatacgc aaaccgcctc tccccgcgcg ttggccgatt cattaatgca gctggcacga
     caggtttccc gactggaaag cgggcagtga gcgcaacgca attaatgtga gttagctcac
     tcattaggca ccccaggctt tacactttat gcttccggct cgtatgttgt gtggaattgt
     gagcggataa caatttcaca caggaaacag ctatgaccat gattacgaat tatgaccatg
     attacgaatt gcggccgccc gggcggccgc agtttggcac tggccagctt ggcactggcc
     gtcgttttac aacgtcgtga ctgggaaaac cctggcgtta cccaacttaa tcgccttgca
     gcacatcccc ctttcgccag ctggcgtaat agcgaagagg cccgcaccga tcgcccttcc
     caacagttgc gcagcctgaa tggcgaatgg cg
//