back Return to this vector's summary.
ID   PJRTAC99   preliminary; circular DNA; SYN; 1392 BP.
XX
AC   X69551; ATCC87018;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pJRtac99 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-1392
RC   pJRtac99 from Tn9 & pDR540 & pGV451, HyRep2 ori
RA   Robben J., Massie G., Bosmans E., Wellens B., Volckaert G.;
RT   "An Escherichia coli plasmid vector system for high-level production
RT   and purification of heterologous peptides fused to active
RT   chloramphenicol acetyltransferase";
RL   Gene 126:109-113(1993).
XX
RN   [2]
RC   pJRtac99 from Tn9 & pDR540 & pGV451, HyRep2 ori
RA   Dekeyzer N., Volckaert G.N.;
RT   "Cloning, expression and purification of a sarcoplasmic
RT   calcium-binding protein from the sandworm Nereis diversicolor via
RT   a fusion product with chloramphenicol acetyltransferase";
RL   Protein Engineering 7:125-130(1994).
XX
CC   MCS. oligonucleotide linker. in GenBank.
CC   Restriction digests of the clone give the following sizes (kb):
CC   EcoRI--1.3; HindIII--1.3; BglII--1.3. (ATCC staff)
CC   Expression vector permitting production of heterologous peptides
CC   fused to active chloramphenicol acetyltransferase. The replicon is
CC   derived from ColE1 and does not contain the RNAII promoter nor most of
CC   the antisense RNAI control element coding sequence. This allows
CC   compatibility with other ColE1 plasmids. Replication depends on
CC   read-through from the tac promoter.  Replication may be negatively
CC   affected by cloning of large inserts or sequences containing a
CC   transcriptional terminator. Repression of this high copy number
CC   plasmid is hard to achieve, even using hosts overproducing lacIq.
CC   Escherichia coli WK6 is recommended for inducible expression.
CC   The vector contains
CC   the following restriction sites (approximate kb from nt 1):
CC   BglII--0.79; ClaI--0.11; EcoRI--0.33; HindIII--0.02; NcoI--0.12;
CC   PstI--0.75; PvuII--0.23. The order of the major features of the
CC   plasmid is: HindIII - tac promoter - NcoI - cat/ScaI/MCS/BglII -
CC   HyRep2 ori. [1]
CC   Growth: LB plus chloramphenicol (25 ug/ml) 37C
CC   Deposited by: Robben J.N., Volckaert G.N.
CC   NM (pJRtac99)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (ATCC)
CC   HO (E.coli)(E.coli BMH71-18)
CC   CP ()
CC   FN (cloning)(expression)(fusion)
CC   SE ()
CC   PA (pGV451 from pBR327)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pDR540, tac promoter 4063bp-
FT                   2. pGV451, HyRep2 ori [from ColE1 ori]
FT                   -> plasmid
FT                   1. plasmid 566bp, HyRep2 ori [from ColE1 ori]
FT                   2. Tn9 TaqI-TaqI 773bp 215..988, cat gene/#V00622
FT                   -> plasmid2 1339bp
FT                   1. plasmid2 ScaI 1339bp 992..992,
FT                   \ Tn9 cat gene or pGV451
FT                   2. oligo MCS 53bp
FT                   \ agtactgcagcgtcgaccagggacccgggtaatgaagagtaactagatct
FT                   \ act
FT                   -> pJRtac99 1392bp"
FT   misc_binding    0..0
FT                   /note="SIT HindIII"
FT   promoter        20..115
FT                   /note="PRO E. coli tac"
FT   misc_binding    0..0
FT                   /note="SIT NcoI"
FT   CDS             121..780
FT                   /note="ANT E. coli chloramphenicol acetyltransferase
FT                   gene (CAT) chloramphenicol resistance gene, mutant,
FT                   EXPERIMENTAL"
FT   misc_binding    752..798
FT                   /note="MCS ScaI-PstI-SalI/AccI-EcoO1091-AvaII-
FT                   XmaI/SmaI/AvaI-EarI-BglII/BstYI
FT                   EXPERIMENTAL"
FT   rep_origin      912..1392
FT                   /note="ORI E. coli HyRep2, from pBR327 ColE1"
XX
SQ   Sequence 1392 BP; 361 A; 325 C; 359 G; 347 T; 0 other;
     acgccagcaa cgcggcccga agcttactcc ccatccccct gttgacaatt aatcatcggc
     tcgtataatg tgtggaattg tgagcggata acaatttcac acaggaaaca ggatcgatcc
     atggagaaaa aaatcactgg atataccacc gttgatatat cccaatggca tcgtaaagaa
     cattttgagg catttcagtc agttgctcaa tgtacctata accagaccgt tcagctggat
     attacggcct ttttaaagac cgtaaagaaa aataagcaca agttttatcc ggcctttatt
     cacattcttg cccgcctgat gaatgctcat ccggaattcc gtatggcaat gaaagacggt
     gagctggtga tatgggatag tgttcaccct tgttacaccg ttttccatga gcaaactgaa
     acgttttcat cgctctggag tgaataccac gacgatttcc ggcagtttct acacatatat
     tcgcaagatg tggcgtgtta cggtgaaaac ctggcctatt tccctaaagg gtttattgag
     aatatgtttt tcgtctcagc caatccctgg gtgagtttca ccagttttga tttaaacgtg
     gccaatatgg acaacttctt cgcccccgtt ttcacaatgg gcaaatatta tacgcaaggc
     gacaaggtgc tgatgccgct ggcgattcag gttcatcatg ccgtttgtga tggcttccat
     gtcggcagaa tgcttaatga attacaacag tactgcagcg tcgaccaggg acccgggtaa
     tgaagagtaa ctagatctac tgcgatgagt ggcagggcgg ggcgtaattt ttttaaggca
     gttattggtg cccttaaacg cctggtgcta cgcctgaata agtgataata agcggatgaa
     tggcagaaat tcgaactggc ttcagcagag cgcagatacc aaatactgtc cttctagtgt
     agccgtagtt aggccaccac ttcaagaact ctgtagcacc gcctacatac ctcgctctgc
     taatcctgtt accagtggct gctgccagtg gcgataagtc gtgtcttacc gggttggact
     caagacgata gttaccggat aaggcgcagc ggtcgggctg aacggggggt tcgtgcacac
     agcccagctt ggagcgaacg acctacaccg aactgagata cctacagcgt gagcattgag
     aaagcgccac gcttcccgaa gggagaaagg cggacaggta tccggtaagc ggcagggtcg
     gaacaggaga gcgcacgagg gagcttccag ggggaaacgc ctggtatctt tatagtcctg
     tcgggtttcg ccacctctga cttgagcgtc gatttttgtg atgctcgtca ggggggcgga
     gcctatggaa aa
//