back Return to this vector's summary.
ID   PK         preliminary; circular DNA; SYN; 2762 BP.
XX
AC   IG5078; ATCC77380;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pK - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pS1 from pUC19 & oligo
RC   pS1-polyA from pS1 & pMAMneo
RC   pS1-MT from pS1 & pT24
RC   pS1-MMTV from pS1 & pMAMneo
RC   pS3 from pS1
RC   pS5 from pS3
RC   pK from pUC19 & oligo
RC   pM from pK & pS1-polyA & pS1-MMTV, RSV LTR/MMTV LTR
RC   pT from pK & pS1-polyA & pS1-MT, MT gene
RC   pM-hyg from pM & pHT, hyg gene
RC   pMB-hyg from pM-hyg & pS5, lacZ-amb
RC   pMB from pMB-hyg
RC   pT-hyg from pT & pHT, hyg gene
RC   pTB-hyg from pT-hyg & pS5, lacZ-amb
RC   pTB from pTB-hyg
RA   Wang Q., Maher V.M., McCormick J.J.;
RT   "Mammalian expression vectors with modulatable promoters and two
RT   multiple cloning sites";
RL   Gene 119:155-161(1992).
XX
RN   [2]
RC   pHT from hyg gene
RA   Drinkwater N.;
RT   ;
RL   Unpublished (1992).
XX
RN   [3]
RC   pT24 from pBR322 & MT gene
RC   pMK from pM & pK
RC   pMT-rasT24-TK from pMK & pT24
RC   pMT-rasT24 from pMT-rasT24-TK & pT24
RA   Reynolds V.L., Lebovitz R.M., Warren S., Hawley T.S., Godwin A.K.,
RA   Lieberman M.W.;
RT   "Regulation of a metallothionein-rasT24 fusion gene by zinc results
RT   in graded alterations in cell morphology and growth";
RL   Oncogene 1:323-330(1987).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   MCS. oligonucleotide linker.
CC   Deposited by: J. Justin McCormick
CC   Cloning vector with a second multiple cloning site inserted at the
CC   KasI site of pUC19 not interrupting lacZ'. [1]
CC   The plasmid contains the following restriction sites (bp from 0):
CC   NotI--0; Nsi--75; PvuI--119, 1907; EcoRI--237; HindIII--288;
CC   SapI--524; DrdI--749, 2618; BsaI--1607; SspI--2342. (personal
CC   communication)
CC   The order of the major features in this plasmid is: NotI/MCSII/NsiI
CC   - 3' lacZ' - EcoRI/MCSI/HindIII - 5' lacZ' - SapI - pMB1 ori - ampR.
CC   [1]
CC   Restriction digests of the clone give the following sizes (kb):
CC   PvuI--1.8, 1.0; EcoRI--2.8; HindIII--2.8; SspI--2.8; ClaI--2.8. (ATCC
CC   staff)
CC   Medium is 1227 LB plus ampicillin.
CC   NM (pK)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (ATCC)
CC   HO (E.coli)(E.coli HB101)(E.coli JM105)(E.coli JM109)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pUC19)
CC   BR ()
CC   OF (pMB)(pTB)
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pUC19 KasI 2686bp 236..236
FT                   blunt end: blunt end
FT                   2. oligo NotI-NsiI/AvaIII 80bp
FT                   \ gcgcggccgctcgcgaatcgatagctagcgcgcactagtctcgaggcgcc
FT                   \ ggcacgcgtacgagatctgttaacatgcat
FT                   -> pK 2766bp"
FT   -               1..235
FT                   /note="pUC19 1..235 235bp
FT                   NarI = GG^CGCC = KasI = G^GCGCC
FT                   \                         gcgcgg..."
FT   -               236..315
FT                   /note="80bp
FT                   \ gcgcggccgctcgcgaatcgatagctagcgcgcactagtctcgaggcgcc
FT                   \ ggcacgcgtacgagatctgttaacatgcat
FT                   \                    ...atgcat
FT                   NarI = GG^CGCC = KasI = G^GCGC C"
FT   -               316..2762
FT                   /note="pUC19 240..2686 2447bp"
FT   misc_binding    0..0
FT                   /note="MCS unique NsiI-HpaI-BglII-SplI-MluI-NaeI-NarI-
FT                   XhoI-SpeI-BssHII-NheI-ClaI-NruI-NotI; MCSII"
FT   misc_binding    0..0
FT                   /note="SIT unique EcoRI-SstI-BanII-KpnI-XmaI-SmaI-
FT                   BamHI-XbaI-SalI-AccI-PstI-HindIII; pUC19 MCS"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   promoter        0..0
FT                   /note="PRO E. coli lac gene"
FT   CDS             0..0
FT                   /note="GEN E. coli beta-galactosidase gene (lacZ');
FT                   reporter gene"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
XX
SQ   Sequence 2762 BP; 682 A; 698 C; 709 G; 673 T; 0 other;
     tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca
     cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg
     ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc
     accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcg
     gccgctcgcg aatcgatagc tagcgcgcac tagtctcgag gcgccggcac gcgtacgaga
     tctgttaaca tgcatcattc gccattcagg ctgcgcaact gttgggaagg gcgatcggtg
     cgggcctctt cgctattacg ccagctggcg aaagggggat gtgctgcaag gcgattaagt
     tgggtaacgc cagggttttc ccagtcacga cgttgtaaaa cgacggccag tgaattcgag
     ctcggtaccc ggggatcctc tagagtcgac ctgcaggcat gcaagcttgg cgtaatcatg
     gtcatagctg tttcctgtgt gaaattgtta tccgctcaca attccacaca acatacgagc
     cggaagcata aagtgtaaag cctggggtgc ctaatgagtg agctaactca cattaattgc
     gttgcgctca ctgcccgctt tccagtcggg aaacctgtcg tgccagctgc attaatgaat
     cggccaacgc gcggggagag gcggtttgcg tattgggcgc tcttccgctt cctcgctcac
     tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta tcagctcact caaaggcggt
     aatacggtta tccacagaat caggggataa cgcaggaaag aacatgtgag caaaaggcca
     gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg tttttccata ggctccgccc
     ccctgacgag catcacaaaa atcgacgctc aagtcagagg tggcgaaacc cgacaggact
     ataaagatac caggcgtttc cccctggaag ctccctcgtg cgctctcctg ttccgaccct
     gccgcttacc ggatacctgt ccgcctttct cccttcggga agcgtggcgc tttctcaatg
     ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca
     cgaacccccc gttcagcccg accgctgcgc cttatccggt aactatcgtc ttgagtccaa
     cccggtaaga cacgacttat cgccactggc agcagccact ggtaacagga ttagcagagc
     gaggtatgta ggcggtgcta cagagttctt gaagtggtgg cctaactacg gctacactag
     aaggacagta tttggtatct gcgctctgct gaagccagtt accttcggaa aaagagttgg
     tagctcttga tccggcaaac aaaccaccgc tggtagcggt ggtttttttg tttgcaagca
     gcagattacg cgcagaaaaa aaggatctca agaagatcct ttgatctttt ctacggggtc
     tgacgctcag tggaacgaaa actcacgtta agggattttg gtcatgagat tatcaaaaag
     gatcttcacc tagatccttt taaattaaaa atgaagtttt aaatcaatct aaagtatata
     tgagtaaact tggtctgaca gttaccaatg cttaatcagt gaggcaccta tctcagcgat
     ctgtctattt cgttcatcca tagttgcctg actccccgtc gtgtagataa ctacgatacg
     ggagggctta ccatctggcc ccagtgctgc aatgataccg cgagacccac gctcaccggc
     tccagattta tcagcaataa accagccagc cggaagggcc gagcgcagaa gtggtcctgc
     aactttatcc gcctccatcc agtctattaa ttgttgccgg gaagctagag taagtagttc
     gccagttaat agtttgcgca acgttgttgc cattgctaca ggcatcgtgg tgtcacgctc
     gtcgtttggt atggcttcat tcagctccgg ttcccaacga tcaaggcgag ttacatgatc
     ccccatgttg tgcaaaaaag cggttagctc cttcggtcct ccgatcgttg tcagaagtaa
     gttggccgca gtgttatcac tcatggttat ggcagcactg cataattctc ttactgtcat
     gccatccgta agatgctttt ctgtgactgg tgagtactca accaagtcat tctgagaata
     gtgtatgcgg cgaccgagtt gctcttgccc ggcgtcaata cgggataata ccgcgccaca
     tagcagaact ttaaaagtgc tcatcattgg aaaacgttct tcggggcgaa aactctcaag
     gatcttaccg ctgttgagat ccagttcgat gtaacccact cgtgcaccca actgatcttc
     agcatctttt actttcacca gcgtttctgg gtgagcaaaa acaggaaggc aaaatgccgc
     aaaaaaggga ataagggcga cacggaaatg ttgaatactc atactcttcc tttttcaata
     ttattgaagc atttatcagg gttattgtct catgagcgga tacatatttg aatgtattta
     gaaaaataaa caaatagggg ttccgcgcac atttccccga aaagtgccac ctgacgtcta
     agaaaccatt attatcatga cattaaccta taaaaatagg cgtatcacga ggccctttcg
     tc
//