back Return to this vector's summary.
ID   PK18       preliminary; circular DNA; SYN; 2661 BP.
XX
AC   M17626;
XX
DT   15-MAR-1989 (Rel. 4, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pK18 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-2661
RC   pK18 from pUC18 & pBR-neo
RC   pK19 from pUC19 & pBR-neo
RA   Pridmore R.D.;
RT   "New and versatile cloning vectors with kanamycin-resistance marker";
RL   Gene 56:309-312(1987).
XX
CC   NM (pK18)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pBRNeo)(pUC18)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 4361bp
FT                   transposition
FT                   2. Tn5 5818bp
FT                   -> pRZ102 10179bp
FT                   1. pRZ102 remove pBR322 sequences
FT                   -> pRZ112
FT                   1. pRZ112 HincII-HincII 2499bp 188..2687, neo gene
FT                   BamHI linker 10bp nnggatccnn:BamHI linker 10bp
FT                   \ nnggatccnn
FT                   HindIII-BamHI 1493bp 1196..2689, neo/kan gene
FT                   2. pBR322 remove HindIII-BamHI 346bp 30..376, 4015bp
FT                   -> pBR-neo 5508bp
FT                   1. pUC18 NarI-DraI/AhaIII 1329bp 237..1566,
FT                   \ ori/lacZ
FT                   2. pBR-neo ClaI-SmaI 1324bp 25..30/1774..3093, neo/kan
FT                   \ pBR322 ClaI 25/pSV2-neo SmaI 1774
FT                   -> plasmid 2614bp
FT                   1. plasmid HindIII 2614bp, kan gene
FT                   Klenow, [makes NheI]
FT                   PstI 2614bp, kan gene
FT                   mutagenesis 27bp ccctgaatgaactccaagacgaggcag
FT                   SphI 2641bp, kan gene
FT                   mutagenesis 20bp caaggcgcggatgccccgac
FT                   -> pK18 2661bp"
FT   misc_binding    0..0
FT                   /note="SIT NheI"
FT   misc_binding    0..0
FT                   /note="SIT BglII"
FT   CDS             365..1159
FT                   /note="ANT E. coli neomycin phosphotransferase gene
FT                   (NPT), neomycin resistance gene (neo),
FT                   Tn5 kanamycin resistance gene (kan)"
FT   misc_binding    0..0
FT                   /note="SIT NcoI"
FT   misc_binding    0..0
FT                   /note="SIT AsuII"
FT   misc_recomb     1332..1333
FT                   /note="pBRNeo DNA end/pUC18 DNA start"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             2400..2661
FT                   /note="GEN E. coli lacZ gene"
XX
SQ   Sequence 2661 BP; 584 A; 724 C; 769 G; 584 T; 0 other;
     cgataagcta gcttcacgct gccgcaagca ctcagggcgc aagggctgct aaaggaagcg
     gaacacgtag aaagccagtc cgcagaaacg gtgctgaccc cggatgaatg tcagctactg
     ggctatctgg acaagggaaa acgcaagcgc aaagagaaag caggtagctt gcagtgggct
     tacatggcga tagctagact gggcggtttt atggacagca agcgaaccgg aattgccagc
     tggggcgccc tctggtaagg ttgggaagcc ctgcaaagta aactggatgg ctttcttgcc
     gccaaggatc tgatggcgca ggggatcaag atctgatcaa gagacaggat gaggatcgtt
     tcgcatgatt gaacaagatg gattgcacgc aggttctccg gccgcttggg tggagaggct
     attcggctat gactgggcac aacagacaat cggctgctct gatgccgccg tgttccggct
     gtcagcgcag gggcgcccgg ttctttttgt caagaccgac ctgtccggtg ccctgaatga
     actccaagac gaggcagcgc ggctatcgtg gctggccacg acgggcgttc cttgcgcagc
     tgtgctcgac gttgtcactg aagcgggaag ggactggctg ctattgggcg aagtgccggg
     gcaggatctc ctgtcatctc accttgctcc tgccgagaaa gtatccatca tggctgatgc
     aatgcggcgg ctgcatacgc ttgatccggc tacctgccca ttcgaccacc aagcgaaaca
     tcgcatcgag cgagcacgta ctcggatgga agccggtctt gtcgatcagg atgatctgga
     cgaagagcat caggggctcg cgccagccga actgttcgcc aggctcaagg cgcggatgcc
     cgacggcgag gatctcgtcg tgacccatgg cgatgcctgc ttgccgaata tcatggtgga
     aaatggccgc ttttctggat tcatcgactg tggccggctg ggtgtggcgg accgctatca
     ggacatagcg ttggctaccc gtgatattgc tgaagagctt ggcggcgaat gggctgaccg
     cttcctcgtg ctttacggta tcgccgctcc cgattcgcag cgcatcgcct tctatcgcct
     tcttgacgag ttcttctgag cgggactctg gggttcgaaa tgaccgacca agcgacgccc
     aacctgccat cacgagattt cgattccacc gccgccttct atgaaaggtt gggcttcgga
     atcgttttcc gggacgccgg ctggatgatc ctccagcgcg gggatctcat gctggagttc
     ttcgcccacc ccaaaaggat ctaggtgaag atcctttttg ataatctcat gaccaaaatc
     ccttaacgtg agttttcgtt ccactgagcg tcagaccccg tagaaaagat caaaggatct
     tcttgagatc ctttttttct gcgcgtaatc tgctgcttgc aaacaaaaaa accaccgcta
     ccagcggtgg tttgtttgcc ggatcaagag ctaccaactc tttttccgaa ggtaactggc
     ttcagcagag cgcagatacc aaatactgtc cttctagtgt agccgtagtt aggccaccac
     ttcaagaact ctgtagcacc gcctacatac ctcgctctgc taatcctgtt accagtggct
     gctgccagtg gcgataagtc gtgtcttacc gggttggact caagacgata gttaccggat
     aaggcgcagc ggtcgggctg aacggggggt tcgtgcacac agcccagctt ggagcgaacg
     acctacaccg aactgagata cctacagcgt gagcattgag aaagcgccac gcttcccgaa
     gggagaaagg cggacaggta tccggtaagc ggcagggtcg gaacaggaga gcgcacgagg
     gagcttccag ggggaaacgc ctggtatctt tatagtcctg tcgggtttcg ccacctctga
     cttgagcgtc gatttttgtg atgctcgtca ggggggcgga gcctatggaa aaacgccagc
     aacgcggcct ttttacggtt cctggccttt tgctggcctt ttgctcacat gttctttcct
     gcgttatccc ctgattctgt ggataaccgt attaccgcct ttgagtgagc tgataccgct
     cgccgcagcc gaacgaccga gcgcagcgag tcagtgagcg aggaagcgga agagcgccca
     atacgcaaac cgcctctccc cgcgcgttgg ccgattcatt aatgcagctg gcacgacagg
     tttcccgact ggaaagcggg cagtgagcgc aacgcaatta atgtgagtta gctcactcat
     taggcacccc aggctttaca ctttatgctt ccggctcgta tgttgtgtgg aattgtgagc
     ggataacaat ttcacacagg aaacagctat gaccatgatt acgaattcga gctcggtacc
     cggggatcct ctagagtcga cctgcaggca tgcaagcttg gcactggccg tcgttttaca
     acgtcgtgac tgggaaaacc ctggcgttac ccaacttaat cgccttgcag cacatccccc
     tttcgccagc tggcgtaata gcgaagaggc ccgcaccgat cgcccttccc aacagttgcg
     cagcctgaat ggcgaatggc g
//