back Return to this vector's summary.

Note: there are two sequence errors in the multiple cloning site region of the original VectorDB sequence, coordinates 2442-2505.

  1. In the correct sequence, there is an additional G residue between positions 2442 and 2443, just upstream of the HindIII site (AAGCTT).
  2. The C residue at position 2502, immediately after the EcoRI site (GAATTC), is not found in the correct sequence.

original: C CCAAGCTTGCATGCC.........CCCCGGGTACCGAGCTCGAATTCCACT | ||||||||||||||| ||||||||||||||||||||||| ||| corrected: CGCCAAGCTTGCATGCC.........CCCCGGGTACCGAGCTCGAATTC ACT


Correct complete sequence of pK19 (thanks to Martin Vesely for contributing this sequence):
FEATURES             Location/Qualifiers     
misc_feature         365..1159                     
                     /note="Km-R (kan/neo)"    
misc_feature         52..2429                    
                     /note="lacZ"     
misc_feature         2429..2522                     
                     /note="polycloning site (pUC19)"

CGATAAGCTAGCTTCACGCTGCCGCAAGCACTCAGGGCGCAAGGGCTGCTAAAGGAAGCGGAACACGTAGAAAGCCAGTCCGCAGAAACGGTGCTGACCC
CGGATGAATGTCAGCTACTGGGCTATCTGGACAAGGGAAAACGCAAGCGCAAAGAGAAAGCAGGTAGCTTGCAGTGGGCTTACATGGCGATAGCTAGACT
GGGCGGTTTTATGGACAGCAAGCGAACCGGAATTGCCAGCTGGGGCGCCCTCTGGTAAGGTTGGGAAGCCCTGCAAAGTAAACTGGATGGCTTTCTTGCC
GCCAAGGATCTGATGGCGCAGGGGATCAAGATCTGATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCG
GCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGG
TTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTCCAAGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGC
TGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAA
GTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTA
CTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGGATGCC
CGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTG
GGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTA
TCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGACCGACCAAGCGACGCCC
AACCTGCCATCACGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGGTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAGCGCG
GGGATCTCATGCTGGAGTTCTTCGCCCACCCCAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTT
CCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTA
CCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGT
AGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTC
GTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACG
ACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCG
GAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTG
ATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCT
GCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCG
AGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGG
CAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGC
GGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAAT
TCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATA
GCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCG

Original pK19 sequence from VectorDB; contains two errors as noted above:
ID   PK19       preliminary; circular DNA; SYN; 2661 BP.
XX
AC   IG9829;
XX
DT   01-JUL-1995 (Rel. 11, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pK19 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pK184 from pK18 & pACYC184
RC   pK194 from pK19 & pACYC184
RA   Jobling M.G., Holmes R.K.;
RT   "Construction of vectors with the p15a replicon, kanamycin
RT   resistance, inducible lacZ alpha and pUC18 or pUC19 multiple
RT   cloning sites";
RL   Nucleic Acids Res. 18:5315-5315(1990).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   NM (pK19)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli XL-1-Blue)(E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pK18)(pUC19)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 4361bp
FT                   transposition
FT                   2. Tn5 5818bp
FT                   -> pRZ102 10179bp
FT                   1. pRZ102 remove pBR322 sequences
FT                   -> pRZ112
FT                   1. pRZ112 HincII-HincII 2499bp 188..2687, Tn5 neo gene
FT                   BamHI linker 10bp nnggatccnn:BamHI linker 10bp
FT                   \ nnggatccnn
FT                   HindIII-BamHI 1493bp 1196..2689, Tn5 neo/kan gene
FT                   2. pBR322 remove HindIII-BamHI 346bp 30..376, 4015bp
FT                   -> pBR-neo 5508bp
FT                   1. pUC19 NarI-DraI/AhaIII 1329bp 237..1566,
FT                   \ ori/lacZ
FT                   2. pBR-neo ClaI-SmaI 1324bp 25..30/1774..3093, neo/kan
FT                   \ pBR322 ClaI 25/pSV2-neo SmaI 1774
FT                   -> plasmid 2614bp
FT                   1. plasmid HindIII 2614bp, kan gene
FT                   Klenow, [makes NheI]
FT                   PstI 2614bp, kan gene
FT                   mutagenesis 27bp ccctgaatgaactccaagacgaggcag
FT                   SphI 2641bp, kan gene
FT                   mutagenesis 20bp caaggcgcggatgccccgac
FT                   -> pK19 2661bp"
FT   -               1..2442
FT                   /note="pK18 1..2442 2442bp"
FT   -               2443..2501
FT                   /note="pUC19 394..452 59bp complement"
FT   -               2502..2661
FT                   /note="pK18 2502..2661 160bp"
FT   misc_binding    0..0
FT                   /note="MCS HindIII-SphI-PstI-SfeI-HincII-AccI-SalI-
FT                   XbaI-BamHI-SmaI-AvaI-KpnI-SstI-EcoRI"
FT   misc_binding    0..0
FT                   /note="SIT unique HindIII-SphI-PstI-HincII-SalI-
FT                   AccI-BamHI-XmaI-SmaI-KpnI-SacI-EcoRI"
FT   rep_origin      0..0
FT                   /note="ORI E. coli miniplasmid p15A"
FT   promoter        0..0
FT                   /note="PRO E. coli lac gene"
FT   CDS             0..0
FT                   /note="GEN E. coli beta-galactosidase gene (lacZ');
FT                   reporter gene"
FT   CDS             0..0
FT                   /note="ANT E. coli kanamycin resistance gene (kan)"
XX
SQ   Sequence 2661 BP; 584 A; 727 C; 766 G; 584 T; 0 other;
     cgataagcta gcttcacgct gccgcaagca ctcagggcgc aagggctgct aaaggaagcg
     gaacacgtag aaagccagtc cgcagaaacg gtgctgaccc cggatgaatg tcagctactg
     ggctatctgg acaagggaaa acgcaagcgc aaagagaaag caggtagctt gcagtgggct
     tacatggcga tagctagact gggcggtttt atggacagca agcgaaccgg aattgccagc
     tggggcgccc tctggtaagg ttgggaagcc ctgcaaagta aactggatgg ctttcttgcc
     gccaaggatc tgatggcgca ggggatcaag atctgatcaa gagacaggat gaggatcgtt
     tcgcatgatt gaacaagatg gattgcacgc aggttctccg gccgcttggg tggagaggct
     attcggctat gactgggcac aacagacaat cggctgctct gatgccgccg tgttccggct
     gtcagcgcag gggcgcccgg ttctttttgt caagaccgac ctgtccggtg ccctgaatga
     actccaagac gaggcagcgc ggctatcgtg gctggccacg acgggcgttc cttgcgcagc
     tgtgctcgac gttgtcactg aagcgggaag ggactggctg ctattgggcg aagtgccggg
     gcaggatctc ctgtcatctc accttgctcc tgccgagaaa gtatccatca tggctgatgc
     aatgcggcgg ctgcatacgc ttgatccggc tacctgccca ttcgaccacc aagcgaaaca
     tcgcatcgag cgagcacgta ctcggatgga agccggtctt gtcgatcagg atgatctgga
     cgaagagcat caggggctcg cgccagccga actgttcgcc aggctcaagg cgcggatgcc
     cgacggcgag gatctcgtcg tgacccatgg cgatgcctgc ttgccgaata tcatggtgga
     aaatggccgc ttttctggat tcatcgactg tggccggctg ggtgtggcgg accgctatca
     ggacatagcg ttggctaccc gtgatattgc tgaagagctt ggcggcgaat gggctgaccg
     cttcctcgtg ctttacggta tcgccgctcc cgattcgcag cgcatcgcct tctatcgcct
     tcttgacgag ttcttctgag cgggactctg gggttcgaaa tgaccgacca agcgacgccc
     aacctgccat cacgagattt cgattccacc gccgccttct atgaaaggtt gggcttcgga
     atcgttttcc gggacgccgg ctggatgatc ctccagcgcg gggatctcat gctggagttc
     ttcgcccacc ccaaaaggat ctaggtgaag atcctttttg ataatctcat gaccaaaatc
     ccttaacgtg agttttcgtt ccactgagcg tcagaccccg tagaaaagat caaaggatct
     tcttgagatc ctttttttct gcgcgtaatc tgctgcttgc aaacaaaaaa accaccgcta
     ccagcggtgg tttgtttgcc ggatcaagag ctaccaactc tttttccgaa ggtaactggc
     ttcagcagag cgcagatacc aaatactgtc cttctagtgt agccgtagtt aggccaccac
     ttcaagaact ctgtagcacc gcctacatac ctcgctctgc taatcctgtt accagtggct
     gctgccagtg gcgataagtc gtgtcttacc gggttggact caagacgata gttaccggat
     aaggcgcagc ggtcgggctg aacggggggt tcgtgcacac agcccagctt ggagcgaacg
     acctacaccg aactgagata cctacagcgt gagcattgag aaagcgccac gcttcccgaa
     gggagaaagg cggacaggta tccggtaagc ggcagggtcg gaacaggaga gcgcacgagg
     gagcttccag ggggaaacgc ctggtatctt tatagtcctg tcgggtttcg ccacctctga
     cttgagcgtc gatttttgtg atgctcgtca ggggggcgga gcctatggaa aaacgccagc
     aacgcggcct ttttacggtt cctggccttt tgctggcctt ttgctcacat gttctttcct
     gcgttatccc ctgattctgt ggataaccgt attaccgcct ttgagtgagc tgataccgct
     cgccgcagcc gaacgaccga gcgcagcgag tcagtgagcg aggaagcgga agagcgccca
     atacgcaaac cgcctctccc cgcgcgttgg ccgattcatt aatgcagctg gcacgacagg
     tttcccgact ggaaagcggg cagtgagcgc aacgcaatta atgtgagtta gctcactcat
     taggcacccc aggctttaca ctttatgctt ccggctcgta tgttgtgtgg aattgtgagc
     ggataacaat ttcacacagg aaacagctat gaccatgatt acccaagctt gcatgcctgc
     aggtcgactc tagaggatcc ccgggtaccg agctcgaatt ccactggccg tcgttttaca
     acgtcgtgac tgggaaaacc ctggcgttac ccaacttaat cgccttgcag cacatccccc
     tttcgccagc tggcgtaata gcgaagaggc ccgcaccgat cgcccttccc aacagttgcg
     cagcctgaat ggcgaatggc g
//