back Return to this vector's summary.
ID   PK194      preliminary; circular DNA; SYN; 2435 BP.
XX
AC   U00800; ATCC37767;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pK194 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pK184 from pK18 & pACYC184
RC   pK194 from pK19 & pACYC184
RA   Jobling M.G., Holmes R.K.;
RT   "Construction of vectors with the p15a replicon, kanamycin
RT   resistance, inducible lacZ alpha and pUC18 or pUC19 multiple
RT   cloning sites";
RL   Nucleic Acids Res. 18:5315-5315(1990).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   pK184 (ATCC 37766) and pK194 (ATCC 37767) have the multiple cloning
CC   sites in opposite orientations, interrupting the lacZalpha coding
CC   sequence.
CC   A general purpose plasmid vector for use in complementation analysis
CC   with plasmids having a ColE1 or pMB1 origin of replication.
CC   Constructed by M. G. Jobling. (personal communication)
CC   Restriction digests of the clone give the following sizes (kb):
CC   EcoRI--2.4; HindIII--2.4; PstI--2.4; BamHI--2.4; XbaI--2.4. (ATCC
CC   staff)
CC   Medium is 1236 LB plus kanamycin.
CC   NM (pK194)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (ATCC)
CC   HO (E.coli XL-1-Blue)(E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pK18)(pUC19)(pACYC184)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 4361bp
FT                   transposition
FT                   2. Tn5 5818bp
FT                   -> pRZ102 10179bp
FT                   1. pRZ102 remove pBR322 sequences
FT                   -> pRZ112
FT                   1. pRZ112 HincII-HincII 2499bp 188..2687, Tn5 neo gene
FT                   BamHI linker 10bp nnggatccnn:BamHI linker 10bp
FT                   \ nnggatccnn
FT                   HindIII-BamHI 1493bp 1196..2689, Tn5 neo/kan gene
FT                   2. pBR322 remove HindIII-BamHI 346bp 30..376, 4015bp
FT                   -> pBR-neo 5508bp
FT                   1. pUC19 NarI-DraI/AhaIII 1329bp 237..1566,
FT                   \ ori/lacZ
FT                   2. pBR-neo ClaI-SmaI 1324bp 25..30/1774..3093, neo/kan
FT                   \ pBR322 ClaI 25/pSV2-neo SmaI 1774
FT                   -> plasmid 2614bp
FT                   1. plasmid HindIII 2614bp, kan gene
FT                   Klenow, [makes NheI]
FT                   PstI 2614bp, kan gene
FT                   mutagenesis 27bp ccctgaatgaactccaagacgaggcag
FT                   SphI 2641bp, kan gene
FT                   mutagenesis 20bp caaggcgcggatgccccgac
FT                   -> pK19 2661bp
FT                   1. pK19 remove BstBI/AsuII-NspI/NspHI 916bp
FT                   \ 1176..2092, pMB1 ori to kan gene/1745bp
FT                   \ pK18 NspI/NspHI 2092 2493
FT                   \ pUC18 NspI = 42 410 811
FT                   \ pUC19 NspI = 42 446 811
FT                   T4 DNA polymerase:T4 DNA polymerase
FT                   2. pACYC184 SacII-ClaI 684bp 836..1520, p15A ori
FT                   T4 DNA polymerase:T4 DNA polymerase
FT                   -> pK194 2432bp [like pK184, except pK19]"
FT   -               1..1177
FT                   /note="pK18 1..1177 1177bp
FT                   AsuII = BstBI = TT^CG AA
FT                   SacII =            CC GC^GG"
FT   -               1178..1865
FT                   /note="pACYC184 834..1521 688bp
FT                   ClaI = AT^CG AT
FT                   NspI =     R CATG^Y"
FT   -               1866..2216
FT                   /note="pK18 2092..2442 351bp"
FT   -               2217..2275
FT                   /note="pUC19 394..452 59bp complement"
FT   -               2276..2435
FT                   /note="pK18 2502..2661 160bp"
FT   misc_binding    0..0
FT                   /note="MCS HindIII-SphI-PstI-SfeI-HincII-AccI-SalI-
FT                   XbaI-BamHI-SmaI-AvaI-KpnI-SstI-EcoRI"
FT   misc_binding    0..0
FT                   /note="SIT unique HindIII-SphI-PstI-HincII-SalI-
FT                   AccI-BamHI-XmaI-SmaI-KpnI-SacI-EcoRI"
FT   rep_origin      0..0
FT                   /note="ORI E. coli miniplasmid p15A"
FT   promoter        0..0
FT                   /note="PRO E. coli lac gene"
FT   CDS             0..0
FT                   /note="GEN E. coli beta-galactosidase gene (lacZ');
FT                   reporter gene"
FT   CDS             0..0
FT                   /note="ANT E. coli kanamycin resistance gene (kan)"
XX
SQ   Sequence 2435 BP; 545 A; 668 C; 675 G; 547 T; 0 other;
     cgataagcta gcttcacgct gccgcaagca ctcagggcgc aagggctgct aaaggaagcg
     gaacacgtag aaagccagtc cgcagaaacg gtgctgaccc cggatgaatg tcagctactg
     ggctatctgg acaagggaaa acgcaagcgc aaagagaaag caggtagctt gcagtgggct
     tacatggcga tagctagact gggcggtttt atggacagca agcgaaccgg aattgccagc
     tggggcgccc tctggtaagg ttgggaagcc ctgcaaagta aactggatgg ctttcttgcc
     gccaaggatc tgatggcgca ggggatcaag atctgatcaa gagacaggat gaggatcgtt
     tcgcatgatt gaacaagatg gattgcacgc aggttctccg gccgcttggg tggagaggct
     attcggctat gactgggcac aacagacaat cggctgctct gatgccgccg tgttccggct
     gtcagcgcag gggcgcccgg ttctttttgt caagaccgac ctgtccggtg ccctgaatga
     actccaagac gaggcagcgc ggctatcgtg gctggccacg acgggcgttc cttgcgcagc
     tgtgctcgac gttgtcactg aagcgggaag ggactggctg ctattgggcg aagtgccggg
     gcaggatctc ctgtcatctc accttgctcc tgccgagaaa gtatccatca tggctgatgc
     aatgcggcgg ctgcatacgc ttgatccggc tacctgccca ttcgaccacc aagcgaaaca
     tcgcatcgag cgagcacgta ctcggatgga agccggtctt gtcgatcagg atgatctgga
     cgaagagcat caggggctcg cgccagccga actgttcgcc aggctcaagg cgcggatgcc
     cgacggcgag gatctcgtcg tgacccatgg cgatgcctgc ttgccgaata tcatggtgga
     aaatggccgc ttttctggat tcatcgactg tggccggctg ggtgtggcgg accgctatca
     ggacatagcg ttggctaccc gtgatattgc tgaagagctt ggcggcgaat gggctgaccg
     cttcctcgtg ctttacggta tcgccgctcc cgattcgcag cgcatcgcct tctatcgcct
     tcttgacgag ttcttctgag cgggactctg gggttcggcg gcaaagccgt ttttccatag
     gctccgcccc cctgacaagc atcacgaaat ctgacgctca aatcagtggt ggcgaaaccc
     gacaggacta taaagatacc aggcgtttcc ccctggcggc tccctcgtgc gctctcctgt
     tcctgccttt cggtttaccg gtgtcattcc gctgttatgg ccgcgtttgt ctcattccac
     gcctgacact cagttccggg taggcagttc gctccaagct ggactgtatg cacgaacccc
     ccgttcagtc cgaccgctgc gccttatccg gtaactatcg tcttgagtcc aacccggaaa
     gacatgcaaa agcaccactg gcagcagcca ctggtaattg atttagagga gttagtcttg
     aagtcatgcg ccggttaagg ctaaactgaa aggacaagtt ttggtgactg cgctcctcca
     agccagttac ctcggttcaa agagttggta gctcagagaa ccttcgaaaa accgccctgc
     aaggcggttt tttcgttttc agagcaagag attacgcgca gaccaaaacg atctcaagaa
     gatcatctta ttaatcagat aaaatatttc tagatttcag tgcaatttat ctcttcaaat
     gtagcacctg aagtcagccc catacgatat aagttgtaat tctcatgttt gacagcttat
     catcgttctt tcctgcgtta tcccctgatt ctgtggataa ccgtattacc gcctttgagt
     gagctgatac cgctcgccgc agccgaacga ccgagcgcag cgagtcagtg agcgaggaag
     cggaagagcg cccaatacgc aaaccgcctc tccccgcgcg ttggccgatt cattaatgca
     gctggcacga caggtttccc gactggaaag cgggcagtga gcgcaacgca attaatgtga
     gttagctcac tcattaggca ccccaggctt tacactttat gcttccggct cgtatgttgt
     gtggaattgt gagcggataa caatttcaca caggaaacag ctatgaccat gattacaagc
     ttgcatgcct gcaggtcgac tctagaggat ccccgggtac cgagctcgaa ttcaccactg
     gccgtcgttt tacaacgtcg tgactgggaa aaccctggcg ttacccaact taatcgcctt
     gcagcacatc cccctttcgc cagctggcgt aatagcgaag aggcccgcac cgatcgccct
     tcccaacagt tgcgcagcct gaatggcgaa tggcg
//