back Return to this vector's summary.
ID   PKG1800    preliminary; circular DNA; SYN; 4746 BP.
XX
AC   IG6014; X51449; V00278; ATCC37127;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pKG1800 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pKG1800 from pKO-1 & gal operon promoter
RA   Bernardi F., Bernardi A.;
RT   "Completed sequence of PKG1800, a vector for determination of
RT   transcription terminators";
RL   DNA Seq. 1:147-151(1990).
XX
RN   [2]
RC   pKG1800
RA   Bernardi A.;
RT   ;
RL   Submitted (18-JAN-1990) to EMBL by:
RL   Bernardi A., CNRS, Laboratoire d'Enzymologie,
RL   91190 Gif Sur Yvette, France.
XX
RN   [3]
RC   [pBR322-Tc from pBR322 & trp promoter]
RC   pKO-1 from pBR322-Tc & galK gene
RC   pKG1800 from pKO-1 & gal operon promoter
RC   pKG1900 from pKO-1 & gal operon promoter
RC   [lambda gal8 from lambda & gal operon promoter]
RC   pKB-2000 from pKO-1 & lambda gal8
RC   pKO-4, pKO-6, pKO-11 from pKO-1
RA   McKenney K., Shimatake H., Court D., Schmeissner U., Brady C.,
RA   Rosenberg M.;
RT   "A system to study promoter and terminator signals recognized by
RT   Escherichia coli RNA polymerase";
RL   Gene Amplif. Anal. 2:383-415(1981).
XX
RN   [4]
RC   pKG1805 from pKG1800 & lambda, nutR/tR1/cII gene
RA   McKenney K.;
RT   ;
RL   Thesis [Johns Hopkins University] 0:0-0(1982).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   Similar to pDS20.
CC   A terminator cloning plasmid vector. (ATCC staff)
CC   Insertion of terminator sequences at the cloning sites causes the
CC   galK+ phenotype to become galK-.  galK+ plasmids are lethal on galETK
CC   hosts because of galactose-1-phosphate accumulation, so
CC   terminator-containing clones survive in galactose media. [2]
CC   Medium is 1227 LB plus ampicillin.
CC   NM (pKG1800)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (ATCC)
CC   HO (E.coli N100)(E.coli)(E.coli S165)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pK01)(gal operon promoter)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pKO-1 remove EcoRI-HindIII 295bp
FT                   \ 3979..3980..294, 3685bp
FT                   2. E.coli EcoRI-HindIII 1061bp 2..1063,
FT                   \ gal operon promoter
FT                   \ aattccgcgtggtgaactcacgtactcagcaagaagcgtatgtgtttgc
FT                   \ accggctacgctgtccaacatttactacggtttcctcgccgtaaacagcc
FT                   \ gtttcaatgctttcggtgatggtgtggcgcaactgggccgctcgctggat
FT                   \ gttgatgccaataccaacggtcaggtggtgatccgtgatagcgccatcaa
FT                   \ cgaaggttttaacacggctaaaccgtgggccgatgcggtgatctctaatc
FT                   \ gtccgtttgcgggtaataccggcagcgtagatgataacgacgaaatacag
FT                   \ cgcaatctgaatgacactaactacaaccgcatgtgggaatacaataaccg
FT                   \ cggcgtgggtagtaaagtggttgcagaggcgaagaagtaagagcaattaa
FT                   \ ctatttgccggacgcggcgtaaacgccttatccggcctacggttcgacgc
FT                   \ atgcaggcatgaaaccgcgtcttttttcagataaaaagcgcaatcattca
FT                   \ taaaccctctgttttataatcacttaatcgcgcataaaaaacggctaaat
FT                   \ tcttgtgtaaacgattccactaatttattccatgtcacacttttcgcatc
FT                   \ tttgttatgctatggttatttcataccataagcctaatggagcgaattat
FT                   \ gagagttctggttaccggtggtagcggttacattggaagtcatacctgtg
FT                   \ tgcaattactgcaaaacggtcatgatgtcatcattcttgataacctctgt
FT                   \ aacagtaagcgcagcgtactgcctgttatcgagcgtttaggcggcaaaca
FT                   \ tccaacgtttgttgaaggcgatattcgtaacgaagcgttgatgaccgaga
FT                   \ tcctgcacgatcacgctatcgacaccgtgatccacttcgccgggctgaaa
FT                   \ gccgtgggcgaatcggtacaaaaaccgctggaatattacgacaacaatgt
FT                   \ caacggcactctgcgcctgattagcgccatgcgcgccgctaacgtcaaaa
FT                   \ actttatttttagctcctccgccaccgtttatggcgatcagcccaaaatt
FT                   \ ccatacgttgaa
FT                   -> pKG1800 4900bp"
FT   -               1..3685
FT                   /note="pKO-1 294..3978 3685bp
FT                   EcoRI = G^AATTC"
FT   -               3686..4746
FT                   /note="1061bp
FT                   \ aattccgcgtggtgaactcacgtactcagcaagaagcgtatgtgtttgc
FT                   \ accggctacgctgtccaacatttactacggtttcctcgccgtaaacagcc
FT                   \ gtttcaatgctttcggtgatggtgtggcgcaactgggccgctcgctggat
FT                   \ gttgatgccaataccaacggtcaggtggtgatccgtgatagcgccatcaa
FT                   \ cgaaggttttaacacggctaaaccgtgggccgatgcggtgatctctaatc
FT                   \ gtccgtttgcgggtaataccggcagcgtagatgataacgacgaaatacag
FT                   \ cgcaatctgaatgacactaactacaaccgcatgtgggaatacaataaccg
FT                   \ cggcgtgggtagtaaagtggttgcagaggcgaagaagtaagagcaattaa
FT                   \ ctatttgccggacgcggcgtaaacgccttatccggcctacggttcgacgc
FT                   \ atgcaggcatgaaaccgcgtcttttttcagataaaaagcgcaatcattca
FT                   \ taaaccctctgttttataatcacttaatcgcgcataaaaaacggctaaat
FT                   \ tcttgtgtaaacgattccactaatttattccatgtcacacttttcgcatc
FT                   \ tttgttatgctatggttatttcataccataagcctaatggagcgaattat
FT                   \ gagagttctggttaccggtggtagcggttacattggaagtcatacctgtg
FT                   \ tgcaattactgcaaaacggtcatgatgtcatcattcttgataacctctgt
FT                   \ aacagtaagcgcagcgtactgcctgttatcgagcgtttaggcggcaaaca
FT                   \ tccaacgtttgttgaaggcgatattcgtaacgaagcgttgatgaccgaga
FT                   \ tcctgcacgatcacgctatcgacaccgtgatccacttcgccgggctgaaa
FT                   \ gccgtgggcgaatcggtacaaaaaccgctggaatattacgacaacaatgt
FT                   \ caacggcactctgcgcctgattagcgccatgcgcgccgctaacgtcaaaa
FT                   \ actttatttttagctcctccgccaccgtttatggcgatcagcccaaaatt
FT                   \ ccatacgttgaa
FT                   HindIII = A^AGCTT"
FT   misc_feature    546..575
FT                   /note="SIT CRP binding site"
FT   promoter        555..569
FT                   /note="PRO E. coli operator region external"
FT   promoter        605..611
FT                   /note="PRO CRP independent promoter"
FT   promoter        610..616
FT                   /note="PRO CRP dependent promoter"
FT   promoter        667..681
FT                   /note="PRO E. coli operator region internal"
FT   CDS             649..1089
FT                   /note="GEN E. coli galactokinase gene (galE);
FT                   truncated (AA 1-146)"
FT   misc_binding    0..0
FT                   /note="SIT unique HindIII-SmaI"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
XX
SQ   Sequence 4746 BP; 1204 A; 1209 C; 1193 G; 1140 T; 0 other;
     agcttactcc ccatccccgg gcaataaggg ctgcacgcgc acttttatcc gcctctgctg
     cgctccgcca ccgtacgtaa atttatggtt ggttatgaaa tgctggcaga gacccagcga
     gacctgaccg cagaacaggc agcagagcgt ttgcgcgcag tcagcgatat ccattttcgc
     gaatccggag tgtaagaaat gagtctgaaa gaaaaaacac aatctctgtt tgccaacgca
     tttggctacc ctgccactca caccattcag gcgcctggcc gcgtgaattt gattggtgaa
     cacaccgact acaacgacgg tttcgttctg ccctgcgcga ttgattatca aaccgtgatc
     agttgtgcac cacgcgatga ccgtaaagtt cgcgtgatgg cagccgatta tgaaaatcag
     ctcgacgagt tttccctcga tgcgcccatt gtcgcacatg aaaactatca atgggctaac
     tacgttcgtg gcgtggtgaa acatctgcaa ctgcgtaaca acagcttcgg cggcgtggac
     atggtgatca gcggcaatgt gccgacgggt gccgggttaa gttcttccgc ttcactggaa
     gtcgcggtcg gaaccgtatt gcagcagctt tatcatctgc cgctggacgg cgcacaaatc
     gcgcttaacg gtcaggaagc agaaaaccag tttgtaggct gtaactgcgg gatcatggat
     cagctaattt ccgcgctcgg caagaaagat catgccttgc tgatcgattg ccgctcactg
     gggaccaaag cagtttccat gcccaaaggt gtggctgtcg tcatcatcaa cagtaacttc
     aaacgtaccc tggttggcag cgaatacaac acccgtcgtg aacagtgcga aaccggtgcg
     cgtttcttcc agcagccagc cctgcgtgat gtcaccattg aagagttcaa cgctgttgcg
     catgaactgg acccgatcgt ggcaaaacgc gtgcgtcata tactgactga aaacgcccgc
     accgttgaag ctgccagcgc gctggagcaa ggcgacctga aacgtatggg cgagttgatg
     gcggagtctc atgcctctat gcgcgatgat ttcgaaatca ccgtgccgca aattgacact
     ctggtagaaa tcgtcaaagc tgtgattggc gacaaaggtg gcgtacgcat gaccggcggc
     ggatttggcg gctgtatcgt cgcgctgatc ccggaagagc tggtgcctgc cgcacagcaa
     gctgtcgctg aacaatatga agcaaaaaca ggtattaaag agacttttta cgtttgtaaa
     ccatcacaag gagcaggaca gtgctgaacg aaactcccgc actggcaccc gatggcagcc
     gtaccgactg ttctgcctcg cgcgtttcgg tgatgacggt gaaaacctct gacacatgca
     gctcccggag acggtcacag cttgtctgta agcggatgcc gggagcagac aagcccgtca
     gggcgcgtca gcgggtgttg gcgggtgtcg gggcgcagcc atgacccagt cacgtagcga
     tagcggagtg tatactggct taactatgcg gcatcagagc agattgtact gagagtgcac
     catatgcggt gtgaaatacc gcacagatgc gtaaggagaa aataccgcat caggcgctct
     tccgcttcct cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca
     gctcactcaa aggcggtaat acggttatcc acagaatcag gggataacgc aggaaagaac
     atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt
     ttccataggc tccgcccccc tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg
     cgaaacccga caggactata aagataccag gcgtttcccc ctggaagctc cctcgtgcgc
     tctcctgttc cgaccctgcc gcttaccgga tacctgtccg cctttctccc ttcgggaagc
     gtggcgcttt ctcatagctc acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc
     aagctgggct gtgtgcacga accccccgtt cagcccgacc gctgcgcctt atccggtaac
     tatcgtcttg agtccaaccc ggtaagacac gacttatcgc cactggcagc agccactggt
     aacaggatta gcagagcgag gtatgtaggc ggtgctacag agttcttgaa gtggtggcct
     aactacggct acactagaag gacagtattt ggtatctgcg ctctgctgaa gccagttacc
     ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt
     ttttttgttt gcaagcagca gattacgcgc agaaaaaaag gatctcaaga agatcctttg
     atcttttcta cggggtctga cgctcagtgg aacgaaaact cacgttaagg gattttggtc
     atgagattat caaaaaggat cttcacctag atccttttaa attaaaaatg aagttttaaa
     tcaatctaaa gtatatatga gtaaacttgg tctgacagtt accaatgctt aatcagtgag
     gcacctatct cagcgatctg tctatttcgt tcatccatag ttgcctgact ccccgtcgtg
     tagataacta cgatacggga gggcttacca tctggcccca gtgctgcaat gataccgcga
     gacccacgct caccggctcc agatttatca gcaataaacc agccagccgg aagggccgag
     cgcagaagtg gtcctgcaac tttatccgcc tccatccagt ctattaattg ttgccgggaa
     gctagagtaa gtagttcgcc agttaatagt ttgcgcaacg ttgttgccat tgctgcaggc
     atcgtggtgt cacgctcgtc gtttggtatg gcttcattca gctccggttc ccaacgatca
     aggcgagtta catgatcccc catgttgtgc aaaaaagcgg ttagctcctt cggtcctccg
     atcgttgtca gaagtaagtt ggccgcagtg ttatcactca tggttatggc agcactgcat
     aattctctta ctgtcatgcc atccgtaaga tgcttttctg tgactggtga gtactcaacc
     aagtcattct gagaatagtg tatgcggcga ccgagttgct cttgcccggc gtcaacacgg
     gataataccg cgccacatag cagaacttta aaagtgctca tcattggaaa acgttcttcg
     gggcgaaaac tctcaaggat cttaccgctg ttgagatcca gttcgatgta acccactcgt
     gcacccaact gatcttcagc atcttttact ttcaccagcg tttctgggtg agcaaaaaca
     ggaaggcaaa atgccgcaaa aaagggaata agggcgacac ggaaatgttg aatactcata
     ctcttccttt ttcaatatta ttgaagcatt tatcagggtt attgtctcat gagcggatac
     atatttgaat gtatttagaa aaataaacaa ataggggttc cgcgcacatt tccccgaaaa
     gtgccacctg acgtctaaga aaccattatt atcatgacat taacctataa aaataggcgt
     atcacgaggc cctttcgtct tcaagaattc cgcgtggtga actcacgtac tcagcaagaa
     gcgtatgtgt ttgcaccggc tacgctgtcc aacatttact acggtttcct cgccgtaaac
     agccgtttca atgctttcgg tgatggtgtg gcgcaactgg gccgctcgct ggatgttgat
     gccaatacca acggtcaggt ggtgatccgt gatagcgcca tcaacgaagg ttttaacacg
     gctaaaccgt gggccgatgc ggtgatctct aatcgtccgt ttgcgggtaa taccggcagc
     gtagatgata acgacgaaat acagcgcaat ctgaatgaca ctaactacaa ccgcatgtgg
     gaatacaata accgcggcgt gggtagtaaa gtggttgcag aggcgaagaa gtaagagcaa
     ttaactattt gccggacgcg gcgtaaacgc cttatccggc ctacggttcg acgcatgcag
     gcatgaaacc gcgtcttttt tcagataaaa agcgcaatca ttcataaacc ctctgtttta
     taatcactta atcgcgcata aaaaacggct aaattcttgt gtaaacgatt ccactaattt
     attccatgtc acacttttcg catctttgtt atgctatggt tatttcatac cataagccta
     atggagcgaa ttatgagagt tctggttacc ggtggtagcg gttacattgg aagtcatacc
     tgtgtgcaat tactgcaaaa cggtcatgat gtcatcattc ttgataacct ctgtaacagt
     aagcgcagcg tactgcctgt tatcgagcgt ttaggcggca aacatccaac gtttgttgaa
     ggcgatattc gtaacgaagc gttgatgacc gagatcctgc acgatcacgc tatcgacacc
     gtgatccact tcgccgggct gaaagccgtg ggcgaatcgg tacaaaaacc gctggaatat
     tacgacaaca atgtcaacgg cactctgcgc ctgattagcg ccatgcgcgc cgctaacgtc
     aaaaacttta tttttagctc ctccgccacc gtttatggcg atcagcccaa aattccatac
     gttgaa
//