back Return to this vector's summary.
ID   PKK2071    preliminary; circular DNA; SYN; 5513 BP.
XX
AC   IG9889;
XX
DT   01-JUL-1995 (Rel. 11, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pKK207-1 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pCI15, pcI16 from pEA305 & pKK233-2
RC   [pKK188-21 from ptac12]
RC   pKK207-1 from ptac12 & linker
RC   pKK216-1 from pKK207-1 & linker
RC   pKK240-11 from pKK216-1 & pKK10-2
RC   pKK217-1 from pKK188-21 & linker
RC   pKK218-1 from pKK217-1
RC   pKK233-2 from pKK218-1 & linker & pKK223-3
RC   pMF105 from pKK240-11
RC   pMF106 from pMF105 & pKK240-11
RC   pUC12-STOP from pUC12
RC   pMF107 from pMF106 & pUC12-STOP
RA   Amann E., Brosius J.;
RT   "ATG vectors for regulated high-level expression of cloned genes in
RT   Escherichia coli";
RL   Gene 40:183-190(1985).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   NM (pKK207-1)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli W3110 lacIq)(E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pKK84-1)(ptac11)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. ptac12 PvuII 2600bp, pBR322 2069..2069
FT                   NcoI linker 8bp accatggt
FT                   -> pKK207-1 2600bp"
FT   -               1..2927
FT                   /note="pKK84-1 1..2927 2927bp
FT                   PvuII = CAG^CTG
FT                   \           accatggt"
FT   -               2928..2935
FT                   /note="accatggt 8bp
FT                   \  accatggt
FT                   PvuII = CAG^CTG"
FT   -               2936..5254
FT                   /note="pKK84-1 2928..5246 2319bp
FT                   ClaI = AT^CGAT
FT                   \         cggctc..."
FT   -               5255..5309
FT                   /note="55bp
FT                   \ cggctcgtataatgtgtggaattgtgagcggataacaatttcacacagga
FT                   \ aacag
FT                   \ ...ggaaacag
FT                   \            cgactgca..."
FT   -               5310..5499
FT                   /note="ptac11 190bp
FT                   \ cgactgcacggtgcaccaatgcttctggcgtcaggcagccatcggaagct
FT                   \ gtggtatggctgtgcaggtcgtaaatcactgcataattcgtgtcgctcaa
FT                   \ ggcgcactcccgttctggataatgttttttgcgccgacatcataacggtt
FT                   \ ctggcaaatattctgaaatgagctgttgacaattaatcat
FT                   TaqI =  T^CGA
FT                   ClaI = AT^CGAT"
FT   -               5500..5513
FT                   /note="pKK84-1 5247..5260 14bp"
FT   misc_binding    0..0
FT                   /note="SIT unique PvuII"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   promoter        0..0
FT                   /note="PRO E. coli tac"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
XX
SQ   Sequence 5513 BP; 1277 A; 1489 C; 1453 G; 1294 T; 0 other;
     gatgctgtag gcataggctt ggttatgccg gtactgccgg gcctcttgcg ggatatcgtc
     cattccgaca gcatcgccag tcactatggc gtgctgctag cgctatatgc gttgatgcaa
     tttctatgcg cacccgttct cggagcactg tccgaccgct ttggccgccg cccagtcctg
     ctcgcttcgc tacttggagc cactatcgac tacgcgatca tggcgaccac acccgtcctg
     tggatcctct acgccggacg catcgtggcc ggcatcaccg gcgccacagg tgcggttgct
     ggcgcctata tcgccgacat caccgatggg gaagatcggg ctcgccactt cgggctcatg
     agcgcttgtt tcggcgtggg tatggtggca ggccccgtgg ccgggggact gttgggcgcc
     atctccttgc atgcaccatt ccttgcggcg gcggtgctca acggcctcaa cctactactg
     ggctgcttcc taatgcagga gtcgcataag ggagagcgtc gaccgatgcc cttgagagcc
     ttcaacccag tcagctcctt ccggtgggcg cggggcatga ctatcgtcgc cgcacttatg
     actgtcttct ttatcatgca actcgtagga caggtgccgg cagcgctctg ggtcattttc
     ggcgaggacc gctttcgctg gagcgcgacg atgatcggcc tgtcgcttgc ggtattcgga
     atcttgcacg ccctcgctca agccttcgtc actggtcccg ccaccaaacg tttcggcgag
     aagcaggcca ttatcgccgg catggcggcc gacgcgctgg gctacgtctt gctggcgttc
     gcgacgcgag gctggatggc cttccccatt atgattcttc tcgcttccgg cggcatcggg
     atgcccgcgt tgcaggccat gctgtccagg caggtagatg acgaccatca gggacagctt
     caaggatcgc tcgcggctct taccagccta acttcgatca ctggaccgct gatcgtcacg
     gcgatttatg ccgcctcggc gagcacatgg aacgggttgg catggattgt aggcgccgcc
     ctataccttg tctgcctccc cgcgttgcgt cgcggtgcat ggagccgggc cacctcgacc
     tgaatggaag ccggcggcac ctcgctaacg gattcaccac tccaagaatt ggagccaatc
     aattcttgcg gagaactgtg aatgcgcaaa ccaacccttg gcagaacata tccatcgcgt
     ccgccatctc cagcagccgc acgcggcgca tcctgttttg gcggatgaga gaagattttc
     agcctgatac agattaaatc agaacgcaga agcggtctga taaaacagaa tttgcctggc
     ggcagtagcg cggtggtccc acctgacccc atgccgaact cagaagtgaa acgccgtagc
     gccgatggta gtgtggggtc tccccatgcg agagtaggga actgccaggc atcaaataaa
     acgaaaggct cagtcgaaag actgggcctt tcgttttatc tgttgtttgt cggtgaacgc
     tctcctgagt aggacaaatc cgccgggagc ggatttgaac gttgcgaagc aacggcccgg
     agggtggcgg gcaggacgcc cgccataaac tgccaggcat caaattaagc agaaggccat
     cctgacggat ggcctttttg cgtttctaca aactcttcct gtcgtcatat ctacaagcca
     tccccccaca gatacggtaa actagcctcg tttttgcatc aggaaagcct gttttggcgg
     atgagagaag attttcagct gatacagatt aaatcagaac gcagaagcgg tctgataaaa
     cagaatttgc ctggcggcag tagcgcggtg gtcccacctg accccatgcc gaactcagaa
     gtgaaacgcc gtagcgccga tggtagtgtg gggtctcccc atgcgagagt agggaactgc
     caggcatcaa ataaaacgaa aggctcagtc gaaagactgg gcctttcgtt ttatctgttg
     tttgtcggtg aacgctctcc tgagtaggac aaatccgccg ggagcggatt tgaacgttgc
     gaagcaacgg cccggagggt ggcgggcagg acgcccgcca taaactgcca ggcatcaaat
     taagcagaag gccatcctga cggatggcct ttttgcgttt ctacaaactc ttcctgtcgt
     catatctaca agccatcccc ccacagatac ggtaaactag cctcgttttt gcatcaggaa
     agcagcgggc agcgttgggt cctggccacg ggtgcgcatg atcgtgctcc tgtcgttgag
     gacccggcta ggctggcggg gttgccttac tggttagcag aatgaatcac cgatacgcga
     gcgaacgtga agcgactgct gctgcaaaac gtctgcgacc tgagcaacaa catgaatggt
     cttcggtttc cgtgtttcgt aaagtctgga aacgcggaag tcagcgccct gcaccattat
     gttccggatc tgcatcgcag gatgctgctg gctaccctgt ggaacaccta catctgtatt
     aacgaagcgc tggcattgac cctgagtgat ttttctctgg tcccgccgca tccataccgc
     cagttgttta ccctcacaac gttccagtaa ccgggcatgt tcatcatcag taacccgtat
     cgtgagcatc ctctctcgtt tcatcggtat cattaccccc atgaacagaa attccccctt
     acacggaggc atcaagtgac caaacaggaa aaaaccgccc ttaacatggc ccgctttatc
     agaagccaga cattaacgct tctggagaaa ctcaacgagc tggacgcgga tgaacaggca
     gacatctgtg aatcgcttca cgaccacgct gatgagcttt accgcagacc atggtctgcc
     tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca
     cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg
     ttggcgggtg tcggggcgca gccatgaccc agtcacgtag cgatagcgga gtgtatactg
     gcttaactat gcggcatcag agcagattgt actgagagtg caccatatgc ggtgtgaaat
     accgcacaga tgcgtaagga gaaaataccg catcaggcgc tcttccgctt cctcgctcac
     tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta tcagctcact caaaggcggt
     aatacggtta tccacagaat caggggataa cgcaggaaag aacatgtgag caaaaggcca
     gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg tttttccata ggctccgccc
     ccctgacgag catcacaaaa atcgacgctc aagtcagagg tggcgaaacc cgacaggact
     ataaagatac caggcgtttc cccctggaag ctccctcgtg cgctctcctg ttccgaccct
     gccgcttacc ggatacctgt ccgcctttct cccttcggga agcgtggcgc tttctcatag
     ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca
     cgaacccccc gttcagcccg accgctgcgc cttatccggt aactatcgtc ttgagtccaa
     cccggtaaga cacgacttat cgccactggc agcagccact ggtaacagga ttagcagagc
     gaggtatgta ggcggtgcta cagagttctt gaagtggtgg cctaactacg gctacactag
     aaggacagta tttggtatct gcgctctgct gaagccagtt accttcggaa aaagagttgg
     tagctcttga tccggcaaac aaaccaccgc tggtagcggt ggtttttttg tttgcaagca
     gcagattacg cgcagaaaaa aaggatctca agaagatcct ttgatctttt ctacggggtc
     tgacgctcag tggaacgaaa actcacgtta agggattttg gtcatgagat tatcaaaaag
     gatcttcacc tagatccttt taaattaaaa atgaagtttt aaatcaatct aaagtatata
     tgagtaaact tggtctgaca gttaccaatg cttaatcagt gaggcaccta tctcagcgat
     ctgtctattt cgttcatcca tagttgcctg actccccgtc gtgtagataa ctacgatacg
     ggagggctta ccatctggcc ccagtgctgc aatgataccg cgagacccac gctcaccggc
     tccagattta tcagcaataa accagccagc cggaagggcc gagcgcagaa gtggtcctgc
     aactttatcc gcctccatcc agtctattaa ttgttgccgg gaagctagag taagtagttc
     gccagttaat agtttgcgca acgttgttgc cattgctgca ggcatcgtgg tgtcacgctc
     gtcgtttggt atggcttcat tcagctccgg ttcccaacga tcaaggcgag ttacatgatc
     ccccatgttg tgcaaaaaag cggttagctc cttcggtcct ccgatcgttg tcagaagtaa
     gttggccgca gtgttatcac tcatggttat ggcagcactg cataattctc ttactgtcat
     gccatccgta agatgctttt ctgtgactgg tgagtactca accaagtcat tctgagaata
     gtgtatgcgg cgaccgagtt gctcttgccc ggcgtcaaca cgggataata ccgcgccaca
     tagcagaact ttaaaagtgc tcatcattgg aaaacgttct tcggggcgaa aactctcaag
     gatcttaccg ctgttgagat ccagttcgat gtaacccact cgtgcaccca actgatcttc
     agcatctttt actttcacca gcgtttctgg gtgagcaaaa acaggaaggc aaaatgccgc
     aaaaaaggga ataagggcga cacggaaatg ttgaatactc atactcttcc tttttcaata
     ttattgaagc atttatcagg gttattgtct catgagcgga tacatatttg aatgtattta
     gaaaaataaa caaatagggg ttccgcgcac atttccccga aaagtgccac ctgacgtcta
     agaaaccatt attatcatga cattaaccta taaaaatagg cgtatcacga ggccctttcg
     tcttcaagaa ttctcatgtt tgacagctta tcatcggctc gtataatgtg tggaattgtg
     agcggataac aatttcacac aggaaacagc gactgcacgg tgcaccaatg cttctggcgt
     caggcagcca tcggaagctg tggtatggct gtgcaggtcg taaatcactg cataattcgt
     gtcgctcaag gcgcactccc gttctggata atgttttttg cgccgacatc ataacggttc
     tggcaaatat tctgaaatga gctgttgaca attaatcatc gataagcttc ttg
//