back Return to this vector's summary.
ID   PKK92C2    preliminary; circular DNA; SYN; 5259 BP.
XX
AC   IG0071;
XX
DT   02-NOV-1992 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pKK92C-2 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pKK92C-2 from pKK84-1
RA   ;
RT   ;
RL   Unpublished (1992).
XX
CC   pKK84-1 has -35 region of tet promoter, but not -10 site.
CC   NM (pKK92C-2)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli HB101)(E.coli DH1)
CC   CP ()
CC   FN (promoter analysis)
CC   SE ()
CC   PA (pKK84-1)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pKK84-1 remove ClaI-EcoRI 26bp 5221..5247,
FT                   \ -35 region/5234bp
FT                   2. EcoRI-BglII-HindIII linker 26bp
FT                   \ gaattcagatctgcgataagcttgcc
FT                   -> pKK92C-2 5259bp"
FT   misc_feature    0..0
FT                   /note="3' residue (c) of EcoRI-BglII-HindIII is
FT                   base number 64 in pBR322"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             23..1213
FT                   /note="ANT E. coli tetracycline resistance gene (tet)"
FT   CDS             1363..1858
FT                   /note="GEN E. coli T1, T2, & 5S genes"
FT   CDS             1859..2355
FT                   /note="GEN E. coli T1, T2, & 5S genes"
FT   terminator      0..0
FT                   /note="TER E. coli rrnB transcription terminator"
FT   CDS             complement(4225..5085)
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
XX
SQ   Sequence 5259 BP; 1213 A; 1432 C; 1391 G; 1223 T; 0 other;
     gatgctgtag gcataggctt ggttatgccg gtactgccgg gcctcttgcg ggatatcgtc
     cattccgaca gcatcgccag tcactatggc gtgctgctag cgctatatgc gttgatgcaa
     tttctatgcg cacccgttct cggagcactg tccgaccgct ttggccgccg cccagtcctg
     ctcgcttcgc tacttggagc cactatcgac tacgcgatca tggcgaccac acccgtcctg
     tggatcctct acgccggacg catcgtggcc ggcatcaccg gcgccacagg tgcggttgct
     ggcgcctata tcgccgacat caccgatggg gaagatcggg ctcgccactt cgggctcatg
     agcgcttgtt tcggcgtggg tatggtggca ggccccgtgg ccgggggact gttgggcgcc
     atctccttgc atgcaccatt ccttgcggcg gcggtgctca acggcctcaa cctactactg
     ggctgcttcc taatgcagga gtcgcataag ggagagcgtc gaccgatgcc cttgagagcc
     ttcaacccag tcagctcctt ccggtgggcg cggggcatga ctatcgtcgc cgcacttatg
     actgtcttct ttatcatgca actcgtagga caggtgccgg cagcgctctg ggtcattttc
     ggcgaggacc gctttcgctg gagcgcgacg atgatcggcc tgtcgcttgc ggtattcgga
     atcttgcacg ccctcgctca agccttcgtc actggtcccg ccaccaaacg tttcggcgag
     aagcaggcca ttatcgccgg catggcggcc gacgcgctgg gctacgtctt gctggcgttc
     gcgacgcgag gctggatggc cttccccatt atgattcttc tcgcttccgg cggcatcggg
     atgcccgcgt tgcaggccat gctgtccagg caggtagatg acgaccatca gggacagctt
     caaggatcgc tcgcggctct taccagccta acttcgatca ctggaccgct gatcgtcacg
     gcgatttatg ccgcctcggc gagcacatgg aacgggttgg catggattgt aggcgccgcc
     ctataccttg tctgcctccc cgcgttgcgt cgcggtgcat ggagccgggc cacctcgacc
     tgaatggaag ccggcggcac ctcgctaacg gattcaccac tccaagaatt ggagccaatc
     aattcttgcg gagaactgtg aatgcgcaaa ccaacccttg gcagaacata tccatcgcgt
     ccgccatctc cagcagccgc acgcggcgca tcctgttttg gcggatgaga gaagattttc
     agcctgatac agattaaatc agaacgcaga agcggtctga taaaacagaa tttgcctggc
     ggcagtagcg cggtggtccc acctgacccc atgccgaact cagaagtgaa acgccgtagc
     gccgatggta gtgtggggtc tccccatgcg agagtaggga actgccaggc atcaaataaa
     acgaaaggct cagtcgaaag actgggcctt tcgttttatc tgttgtttgt cggtgaacgc
     tctcctgagt aggacaaatc cgccgggagc ggatttgaac gttgcgaagc aacggcccgg
     agggtggcgg gcaggacgcc cgccataaac tgccaggcat caaattaagc agaaggccat
     cctgacggat ggcctttttg cgtttctaca aactcttcct gtcgtcatat ctacaagcca
     tccccccaca gatacggtaa actagcctcg tttttgcatc aggaaagcct gttttggcgg
     atgagagaag attttcagct gatacagatt aaatcagaac gcagaagcgg tctgataaaa
     cagaatttgc ctggcggcag tagcgcggtg gtcccacctg accccatgcc gaactcagaa
     gtgaaacgcc gtagcgccga tggtagtgtg gggtctcccc atgcgagagt agggaactgc
     caggcatcaa ataaaacgaa aggctcagtc gaaagactgg gcctttcgtt ttatctgttg
     tttgtcggtg aacgctctcc tgagtaggac aaatccgccg ggagcggatt tgaacgttgc
     gaagcaacgg cccggagggt ggcgggcagg acgcccgcca taaactgcca ggcatcaaat
     taagcagaag gccatcctga cggatggcct ttttgcgttt ctacaaactc ttcctgtcgt
     catatctaca agccatcccc ccacagatac ggtaaactag cctcgttttt gcatcaggaa
     agcagtcggg cagcgttggg tcctggccac gggtgcgcat gatcgtgctc ctgtcgttga
     ggacccggct aggctggcgg ggttgcctta ctggttagca gaatgaatca ccgatacgcg
     agcgaacgtg aagcgactgc tgctgcaaaa cgtctgcgac ctgagcaaca acatgaatgg
     tcttcggttt ccgtgtttcg taaagtctgg aaacgcggaa gtcagcgccc tgcaccatta
     tgttccggat ctgcatcgca ggatgctgct ggctaccctg tggaacacct acatctgtat
     taacgaagcg ctggcattga ccctgagtga tttttctctg gtcccgccgc atccataccg
     ccagttgttt accctcacaa cgttccagta accgggcatg ttcatcatca gtaacccgta
     tcgtgagcat cctctctcgt ttcatcggta tcattacccc catgaacaga aattccccct
     tacacggagg catcaagtga ccaaacagga aaaaaccgcc cttaacatgg cccgctttat
     cagaagccag acattaacgc ttctggagaa actcaacgag ctggacgcgg atgaacaggc
     agacatctgt gaatcgcttc acgaccacgc tgatgagctt taccgcagct gcctcgcgcg
     tttcggtgat gacggtgaaa acctctgaca catgcagctc ccggagacgg tcacagcttg
     tctgtaagcg gatgccggga gcagacaagc ccgtcagggc gcgtcagcgg gtgttggcgg
     gtgtcggggc gcagccatga cccagtcacg tagcgatagc ggagtgtata ctggcttaac
     tatgcggcat cagagcagat tgtactgaga gtgcaccata tgcggtgtga aataccgcac
     agatgcgtaa ggagaaaata ccgcatcagg cgctcttccg cttcctcgct cactgactcg
     ctgcgctcgg tcgttcggct gcggcgagcg gtatcagctc actcaaaggc ggtaatacgg
     ttatccacag aatcagggga taacgcagga aagaacatgt gagcaaaagg ccagcaaaag
     gccaggaacc gtaaaaaggc cgcgttgctg gcgtttttcc ataggctccg cccccctgac
     gagcatcaca aaaatcgacg ctcaagtcag aggtggcgaa acccgacagg actataaaga
     taccaggcgt ttccccctgg aagctccctc gtgcgctctc ctgttccgac cctgccgctt
     accggatacc tgtccgcctt tctcccttcg ggaagcgtgg cgctttctca tagctcacgc
     tgtaggtatc tcagttcggt gtaggtcgtt cgctccaagc tgggctgtgt gcacgaaccc
     cccgttcagc ccgaccgctg cgccttatcc ggtaactatc gtcttgagtc caacccggta
     agacacgact tatcgccact ggcagcagcc actggtaaca ggattagcag agcgaggtat
     gtaggcggtg ctacagagtt cttgaagtgg tggcctaact acggctacac tagaaggaca
     gtatttggta tctgcgctct gctgaagcca gttaccttcg gaaaaagagt tggtagctct
     tgatccggca aacaaaccac cgctggtagc ggtggttttt ttgtttgcaa gcagcagatt
     acgcgcagaa aaaaaggatc tcaagaagat cctttgatct tttctacggg gtctgacgct
     cagtggaacg aaaactcacg ttaagggatt ttggtcatga gattatcaaa aaggatcttc
     acctagatcc ttttaaatta aaaatgaagt tttaaatcaa tctaaagtat atatgagtaa
     acttggtctg acagttacca atgcttaatc agtgaggcac ctatctcagc gatctgtcta
     tttcgttcat ccatagttgc ctgactcccc gtcgtgtaga taactacgat acgggagggc
     ttaccatctg gccccagtgc tgcaatgata ccgcgagacc cacgctcacc ggctccagat
     ttatcagcaa taaaccagcc agccggaagg gccgagcgca gaagtggtcc tgcaacttta
     tccgcctcca tccagtctat taattgttgc cgggaagcta gagtaagtag ttcgccagtt
     aatagtttgc gcaacgttgt tgccattgct gcaggcatcg tggtgtcacg ctcgtcgttt
     ggtatggctt cattcagctc cggttcccaa cgatcaaggc gagttacatg atcccccatg
     ttgtgcaaaa aagcggttag ctccttcggt cctccgatcg ttgtcagaag taagttggcc
     gcagtgttat cactcatggt tatggcagca ctgcataatt ctcttactgt catgccatcc
     gtaagatgct tttctgtgac tggtgagtac tcaaccaagt cattctgaga atagtgtatg
     cggcgaccga gttgctcttg cccggcgtca acacgggata ataccgcgcc acatagcaga
     actttaaaag tgctcatcat tggaaaacgt tcttcggggc gaaaactctc aaggatctta
     ccgctgttga gatccagttc gatgtaaccc actcgtgcac ccaactgatc ttcagcatct
     tttactttca ccagcgtttc tgggtgagca aaaacaggaa ggcaaaatgc cgcaaaaaag
     ggaataaggg cgacacggaa atgttgaata ctcatactct tcctttttca atattattga
     agcatttatc agggttattg tctcatgagc ggatacatat ttgaatgtat ttagaaaaat
     aaacaaatag gggttccgcg cacatttccc cgaaaagtgc cacctgacgt ctaagaaacc
     attattatca tgacattaac ctataaaaat aggcgtatca cgaggccctt tcgtcttcaa
     gaattcagat ctgcgataag cttggcgata agcttcttg
//