back Return to this vector's summary.
ID   PKLY3      preliminary; circular DNA; SYN; 4871 BP.
XX
AC   IG5070;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pKLY3 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pKLY1 from pKK233-2 & pEMBL8, f1 ori
RC   pKLY2 from pKLY1
RC   pKLY3 from pKLY2 & oligo, ColE2-P9 celB gene
RC   pKLXP2, pKLYP2 from pKLY3 & oligo
RC   pKLYPHOA, pKLXPHOA from pKLY3 & pCH2, PhoA gene
RA   Rioux C.R., Bergeron H., Lin L., Grothe S., O'Connor-McCourt M.,
RA   Lau P.C.;
RT   "A fusion plasmid for the synthesis of lipopeptide-antigen chimeras
RT   in Escherichia coli";
RL   Gene 116:13-20(1992).
XX
RN   [2]
RC   pCol3 from ColE2-P9 & pUC8
RA   Cole S.T., Saint-Joanis B., Pugsley A.P.;
RT   "Molecular characterization of the colicin E2 operon and
RT   identification of its products";
RL   Mol. Gen. Genet. 198:465-472(1985).
XX
RN   [3]
RC   pCHAP23 from celB gene
RC   pCHAP24 from celB gene
RA   Pugsley A.P., Schwartz M.;
RT   "Colicin E2 release: lysis, leakage or secretion? possible role of
RT   a phospholipase";
RL   EMBO J. 3:2393-2397(1984).
XX
RN   [4]
RC   ColE2-P9 from ColE2, colicin E2 gene
RC   pAPIP219 from ColE2-P9 & pUR222
RA   Pugsley A.P., Schwartz M.;
RT   "A genetic approach to the study of mitomycin-induced lysis of
RT   Escherichia coli K-12 strains which produce colicin E2";
RL   Mol. Gen. Genet. 190:366-372(1983).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   oligonucleotide insert. signal sequence.
CC   NM (pKLY3)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pKK233-2)(pEMBL8+)(pColE2-P9)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pKK233-2 PvuII 4593bp 1697..1697
FT                   calf intestinal phosphatase
FT                   2. pEMBL8+ RsaI-RsaI 514bp 771..1285, f1 ori
FT                   -> pKLY1 5107bp
FT                   1. pKLY1 remove EcoRI-SalI 283bp 4590..4593..280,
FT                   \ 4832bp [275bp]
FT                   -> pKLY2 4832bp
FT                   1. pKLY2 NcoI-HindIII 4818bp,
FT                   \ MCS/pKK233-2 4316..-..4302
FT                   2. oligo NcoI-HindIII 62bp
FT                   \ ccatgaaactgtctgcatgccaggcaaactacgtataactaactaaggat
FT                   \ ccctgcaagctt, ColE2-P9 celB gene 5' end
FT                   -> pKLY3 4916bp [unique SphI in celB, SnaBI, no NcoI]"
FT   -               1..1417
FT                   /note="pKK233-2 280..1696 1417bp
FT                   PvuII = CAG^CTG
FT                   RsaI =   GT^AC"
FT   -               1418..1931
FT                   /note="pEMBL8+ 771..1284 514bp
FT                   RsaI =   GT^AC
FT                   PvuII = CAG^CTG"
FT   -               1932..4536
FT                   /note="pKK233-2 1697..4301 2605bp
FT                   HindIII = A^AGCTT
FT                   \           agctt..."
FT   -               4537..4593
FT                   /note="57bp
FT                   \ agcttgcagggatccttagttagttatacgtagtttgcctggcatgcaga
FT                   \ cagtttc
FT                   \ ...cagtttc
FT                   NcoI =     C^CATGG"
FT   -               4594..4871
FT                   /note="pKK233-2 4316..4593 278bp
FT                   EcoRI = G^AATT C
FT                   SalI =       G^TCGAC"
FT   misc_feature    0..0
FT                   /note="ColE2-P9 celB gene 5' end signal peptide"
FT   misc_binding    0..0
FT                   /note="SIT Spase II"
FT   misc_feature    0..0
FT                   /note="ColE2-P9 beta turn peptide"
FT   CDS             0..0
FT                   /note="GEN E. coli rrnB 5S gene"
FT   terminator      0..0
FT                   /note="GEN E. coli rrnB 5S gene terminator T1T2"
FT   misc_binding    0..0
FT                   /note="SIT SspI"
FT   CDS             0..0
FT                   /note="ANT E. coli amp gene"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   rep_origin      0..0
FT                   /note="ORI phage f1 ori"
FT   misc_binding    0..0
FT                   /note="SIT SspI"
FT   misc_binding    0..0
FT                   /note="SIT SalI"
FT   misc_binding    0..0
FT                   /note="SIT EcoRI"
FT   promoter        0..0
FT                   /note="GEN E. coli trc promoter"
FT   misc_binding    0..0
FT                   /note="SIT SspI"
XX
SQ   Sequence 4871 BP; 1125 A; 1318 C; 1219 G; 1209 T; 0 other;
     tcgaccgatg cccttgagag ccttcaaccc agtcagctcc ttccggtggg cgcggggcat
     gactatcgtc gccgcactta tgactgtctt ctttatcatg caactcgtag gacaggtgcc
     ggcagcgctc tgggtcattt tcggcgagga ccgctttcgc tggagcgcga cgatgatcgg
     cctgtcgctt gcggtattcg gaatcttgca cgccctcgct caagccttcg tcactggtcc
     cgccaccaaa cgtttcggcg agaagcaggc cattatcgcc ggcatggcgg ccgacgcgct
     gggctacgtc ttgctggcgt tcgcgacgcg aggctggatg gccttcccca ttatgattct
     tctcgcttcc ggcggcatcg ggatgcccgc gttgcaggcc atgctgtcca ggcaggtaga
     tgacgaccat cagggacagc ttcaaggatc gctcgcggct cttaccagcc taacttcgat
     cactggaccg ctgatcgtca cggcgattta tgccgcctcg gcgagcacat ggaacgggtt
     ggcatggatt gtaggcgccg ccctatacct tgtctgcctc cccgcgttgc gtcgcggtgc
     atggagccgg gccacctcga cctgaatgga agccggcggc acctcgctaa cggattcacc
     actccaagaa ttggagccaa tcaattcttg cggagaactg tgaatgcgca aaccaaccct
     tggcagaaca tatccatcgc gtccgccatc tccagcagcc gcacgcggcg catctcgggc
     agcgttgggt cctggccacg ggtgcgcatg atcgtgctcc tgtcgttgag gacccggcta
     ggctggcggg gttgccttac tggttagcag aatgaatcac cgatacgcga gcgaacgtga
     agcgactgct gctgcaaaac gtctgcgacc tgagcaacaa catgaatggt cttcggtttc
     cgtgtttcgt aaagtctgga aacgcggaag tcagcgccct gcaccattat gttccggatc
     tgcatcgcag gatgctgctg gctaccctgt ggaacaccta catctgtatt aacgaagcgc
     tggcattgac cctgagtgat ttttctctgg tcccgccgca tccataccgc cagttgttta
     ccctcacaac gttccagtaa ccgggcatgt tcatcatcag taacccgtat cgtgagcatc
     ctctctcgtt tcatcggtat cattaccccc atgaacagaa attccccctt acacggaggc
     atcaagtgac caaacaggaa aaaaccgccc ttaacatggc ccgctttatc agaagccaga
     cattaacgct tctggagaaa ctcaacgagc tggacgcgga tgaacaggca gacatctgtg
     aatcgcttca cgaccacgct gatgagcttt accgcagacg cgccctgtag cggcgcatta
     agcgcggcgg gtgtggtggt tacgcgcagc gtgaccgcta cacttgccag cgccctagcg
     cccgctcctt tcgctttctt cccttccttt ctcgccacgt tcgccggctt tccccgtcaa
     gctctaaatc gggggctccc tttagggttc cgatttagtg ctttacggca cctcgacccc
     aaaaaacttg attagggtga tggttcacgt agtgggccat cgccctgata gacggttttt
     cgccctttga cgttggagtc cacgttcttt aatagtggac tcttgttcca aactggaaca
     acactcaacc ctatctcggt ctattctttt gatttataag ggattttgcc gatttcggcc
     tattggttaa aaaatgagct gatttaacaa aaatttaacg cgaattttaa caaaatatta
     acgtttacaa tttaaatatt tgcttataca atcttcctgt ttttggggct tttctgatta
     tcaaccgggg tctgcctcgc gcgtttcggt gatgacggtg aaaacctctg acacatgcag
     ctcccggaga cggtcacagc ttgtctgtaa gcggatgccg ggagcagaca agcccgtcag
     ggcgcgtcag cgggtgttgg cgggtgtcgg ggcgcagcca tgacccagtc acgtagcgat
     agcggagtgt atactggctt aactatgcgg catcagagca gattgtactg agagtgcacc
     atatgcggtg tgaaataccg cacagatgcg taaggagaaa ataccgcatc aggcgctctt
     ccgcttcctc gctcactgac tcgctgcgct cggtcgttcg gctgcggcga gcggtatcag
     ctcactcaaa ggcggtaata cggttatcca cagaatcagg ggataacgca ggaaagaaca
     tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt
     tccataggct ccgcccccct gacgagcatc acaaaaatcg acgctcaagt cagaggtggc
     gaaacccgac aggactataa agataccagg cgtttccccc tggaagctcc ctcgtgcgct
     ctcctgttcc gaccctgccg cttaccggat acctgtccgc ctttctccct tcgggaagcg
     tggcgctttc tcatagctca cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca
     agctgggctg tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta tccggtaact
     atcgtcttga gtccaacccg gtaagacacg acttatcgcc actggcagca gccactggta
     acaggattag cagagcgagg tatgtaggcg gtgctacaga gttcttgaag tggtggccta
     actacggcta cactagaagg acagtatttg gtatctgcgc tctgctgaag ccagttacct
     tcggaaaaag agttggtagc tcttgatccg gcaaacaaac caccgctggt agcggtggtt
     tttttgtttg caagcagcag attacgcgca gaaaaaaagg atctcaagaa gatcctttga
     tcttttctac ggggtctgac gctcagtgga acgaaaactc acgttaaggg attttggtca
     tgagattatc aaaaaggatc ttcacctaga tccttttaaa ttaaaaatga agttttaaat
     caatctaaag tatatatgag taaacttggt ctgacagtta ccaatgctta atcagtgagg
     cacctatctc agcgatctgt ctatttcgtt catccatagt tgcctgactc cccgtcgtgt
     agataactac gatacgggag ggcttaccat ctggccccag tgctgcaatg ataccgcgag
     acccacgctc accggctcca gatttatcag caataaacca gccagccgga agggccgagc
     gcagaagtgg tcctgcaact ttatccgcct ccatccagtc tattaattgt tgccgggaag
     ctagagtaag tagttcgcca gttaatagtt tgcgcaacgt tgttgccatt gctacaggca
     tcgtggtgtc acgctcgtcg tttggtatgg cttcattcag ctccggttcc caacgatcaa
     ggcgagttac atgatccccc atgttgtgca aaaaagcggt tagctccttc ggtcctccga
     tcgttgtcag aagtaagttg gccgcagtgt tatcactcat ggttatggca gcactgcata
     attctcttac tgtcatgcca tccgtaagat gcttttctgt gactggtgag tactcaacca
     agtcattctg agaatagtgt atgcggcgac cgagttgctc ttgcccggcg tcaacacggg
     ataataccgc gccacatagc agaactttaa aagtgctcat cattggaaaa cgttcttcgg
     ggcgaaaact ctcaaggatc ttaccgctgt tgagatccag ttcgatgtaa cccactcgtg
     cacccaactg atcttcagca tcttttactt tcaccagcgt ttctgggtga gcaaaaacag
     gaaggcaaaa tgccgcaaaa aagggaataa gggcgacacg gaaatgttga atactcatac
     tcttcctttt tcaatattat tgaagcattt atcagggtta ttgtctcatg agcggataca
     tatttgaatg tatttagaaa aataaacaaa aagagtttgt agaaacgcaa aaaggccatc
     cgtcaggatg gccttctgct taatttgatg cctggcagtt tatggcgggc gtcctgcccg
     ccaccctccg ggccgttgct tcgcaacgtt caaatccgct cccggcggat ttgtcctact
     caggagagcg ttcaccgaca aacaacagat aaaacgaaag gcccagtctt tcgactgagc
     ctttcgtttt atttgatgcc tggcagttcc ctactctcgc atggggagac cccacactac
     catcggcgct acggcgtttc acttctgagt tcggcatggg gtcaggtggg accaccgcgc
     tactgccgcc aggcaaactg ttttatcaga ccgcttctgc gttctgattt aatctgtatc
     aggctgaaaa tcttctctca tccgccaaaa cagccaagct tgcagggatc cttagttagt
     tatacgtagt ttgcctggca tgcagacagt ttccatggtc tgtttcctgt gtgaaattgt
     tatccgctca caattccaca cattatacga gccggatgat taattgtcaa cagctcattt
     cagaatattt gccagaaccg tttatatgtc ggcgcaaaaa acattatcca gaacgggagt
     gcgccttgag cgacacgaat tatgcagtga tttacgacct gcacagccaa tccacagctt
     ccgatggctg cctgacgcca gaagcattgg tgcaccgtgc agtcgatgat aagctgtcaa
     acatgagaat t
//