back Return to this vector's summary.
ID   PKM2       preliminary; circular DNA; SYN; 4157 BP.
XX
AC   L08922; VB0125;
XX
DT   04-JUN-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pKM2 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-4157
RC   pKM2
RA   Gilbert W.;
RT   "Obtained from VecBase 3.0";
RL   Unpublished (1991).
XX
RN   [2]
RC   pKO-II from pKO-1 & pPCV
RC   pKO-2 from pKO-II
RC   pKM-II from pKM-1 & pPCV
RC   pKM-2 from pKM-II
RA   De Boer H.A.;
RT   "A versatile plasmid system for the study of prokayotic
RT   transcription signals in Escherichia coli";
RL   Gene 30:251-255(1984).
XX
CC   These data and their annotation were supplied to GenBank by Will
CC   Gilbert under the auspices of the GenBank Currator Program.
CC
CC   Assembled from pKO2 and phage lambda by F. Pfeiffer.
CC   This is a promoter probe vector. The promoterless galK gene is
CC   used as selectable marker. Translationsal stop codons in all reading
CC   frames are present on a 11-bp oligonucleotide before the galKgene.
CC   Also, a polylinker was cloned before this gene. In addition, the
CC   lambda tr1 transcription terminator was inserted BEFORE the galK gene
CC   to allow measurement of very strong promoters due to read-through
CC   transcription.
CC   pKM2 does not contain the 4-bp deletion present in pKO2.
CC   However, in GenBank SYNPKO2 and SYNPKM2 have been mixed up. Thus,
CC   SYNPKO2 is given as a parent.
CC   NM (pKM2)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (promoter analysis)
CC   SE ()
CC   PA (pKM1)(EcoGalK)(pBR322)(pKO-2)(lambda)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 ClaI 4361bp 25..25
FT                   2. oligo ClaI-SacI-XhoI-XbaI-ClaI 21bp
FT                   \ cggagctctcgagtctagaat
FT                   -> pPCV 4382bp [unique ClaI, no tet promoter]
FT                   1. pKM-1 PvuII
FT                   S1 nuclease
FT                   remove small PstI-HindIII
FT                   2. pPCV small PstI-HindIII
FT                   -> pKM-II
FT                   1. pKM-II ClaI-HindIII
FT                   2. oligo ClaI-SmaI-HindIII 32bp
FT                   \ cgatcccgggaagcttaactaactaacagctt, stop codons
FT                   -> pKM-2 4157bp"
FT   misc_feature    1..102
FT                   /note="synthetic oligonucleotide"
FT   misc_binding    1..61
FT                   /note="MCS EcoRI-SacI-XhoI-XbaI-ClaI-SmaI-HindIII"
FT   terminator      61..72
FT                   /note="TER synthetic stop-codons"
FT   misc_feature    91..448
FT                   /note="from lambda"
FT   CDS             500..1862
FT                   /note="GEN E. coli galactokinase gene (galK)"
FT   misc_feature    1863..4157
FT                   /note="from pBR322"
FT   CDS             3092..3880
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
XX
SQ   Sequence 4157 BP; 1071 A; 1050 C; 1048 G; 988 T; 0 other;
     ttctcatgtt tgacagctta tcatcggagc tctcgagtct agaatcgatc ccgggaagct
     taactaacta acagcttact ccccatgccc ccgaaagatt tttttaacta taaacgctga
     tggaagcgtt tatgcggaag aggtaaagcc cttcccgagt aacaaaaaaa caacagcata
     aataaccccg ctcttacaca ttccagccct gaaaaagggc atcaaattaa accacaccta
     tggtgtatgc atttatttgc atacattcaa tcaattgtta tctaaggaaa tacttacata
     tggttcgtgc aaacaaacgc aacgaggctc tacgaatcga gagtgcgttg cttaacaaaa
     tcgcaatgct tggaactgag aagacagcgg aagctgtggg cgttgataag tcgcagatca
     gcaggtggaa gagggactgg attccaaagt tctcaatgct gcttgctgtt cttgaatggg
     gggtcgttgg gcaataaggg ctgcacgcgc acttttatcc gcctctgctg cgctccgcca
     ccgtacgtaa atttatggtt ggttatgaaa tgctggcaga gacccagcga gacctgaccg
     cagaacaggc agcagagcgt ttgcgcgcag tcagcgatat ccattttcgc gaatccggag
     tgtaagaaat gagtctgaaa gaaaaaacac aatctctgtt tgccaacgca tttggctacc
     ctgccactca caccattcag gcgcctggcc gcgtgaattt gattggtgaa cacaccgact
     acaacgacgg tttcgttctg ccctgcgcga ttgattatca aaccgtgatc agttgtgcac
     cacgcgatga ccgtaaagtt cgcgtgatgg cagccgatta tgaaaatcag ctcgacgagt
     tttccctcga tgcgcccatt gtcgcacatg aaaactatca atgggctaac tacgttcgtg
     gcgtggtgaa acatctgcaa ctgcgtaaca acagcttcgg cggcgtggac atggtgatca
     gcggcaatgt gccgacgggt gccgggttaa gttcttccgc ttcactggaa gtcgcggtcg
     gaaccgtatt gcagcagctt tatcatctgc cgctggacgg cgcacaaatc gcgcttaacg
     gtcaggaagc agaaaaccag tttgtaggct gtaactgcgg gatcatggat cagctaattt
     ccgcgctcgg caagaaagat catgccttgc tgatcgattg ccgctcactg gggaccaaag
     cagtttccat gcccaaaggt gtggctgtcg tcatcatcaa cagtaacttc aaacgtaccc
     tggttggcag cgaatacaac acccgtcgtg aacagtgcga aaccggtgcg cgtttcttcc
     agcagccagc cctgcgtgat gtcaccattg aagagttcaa cgctgttgcg catgaactgg
     acccgatcgt ggcaaaacgc gtgcgtcata tactgactga aaacgcccgc accgttgaag
     ctgccagcgc gctggagcaa ggcgacctga aacgtatggg cgagttgatg gcggagtctc
     atgcctctat gcgcgatgat ttcgaaatca ccgtgccgca aattgacact ctggtagaaa
     tcgtcaaagc tgtgattggc gacaaaggtg gcgtacgcat gaccggcggc ggatttggcg
     gctgtatcgt cgcgctgatc ccggaagagc tggtgcctgc cgcacagcaa gctgtcgctg
     aacaatatga agcaaaaaca ggtattaaag agacttttta cgtttgtaaa ccatcacaag
     gagcaggaca gtgctgaacg aaactcccgc actggcaccc gatggcagcc gtaccgactg
     ttctgcctcg cgcgtttcgg tgatgacggt gaaaacctct gacacatgca gctcccggag
     acggtcacag cttgtctgta agcggatgcc gggagcagac aagcccgtca gggcgcgtca
     gcgggtgttg gcgggtgtcg gggcgcagcc atgacccagt cacgtagcga tagcggagtg
     tatactggct taactatgcg gcatcagagc agattgtact gagagtgcac catatgcggt
     gtgaaatacc gcacagatgc gtaaggagaa aataccgcat caggcgctct tccgcttcct
     cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca gctcactcaa
     aggcggtaat acggttatcc acagaatcag gggataacgc aggaaagaac atgtgagcaa
     aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc
     tccgcccccc tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga
     caggactata aagataccag gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc
     cgaccctgcc gcttaccgga tacctgtccg cctttctccc ttcgggaagc gtggcgcttt
     ctcatagctc acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc aagctgggct
     gtgtgcacga accccccgtt cagcccgacc gctgcgcctt atccggtaac tatcgtcttg
     agtccaaccc ggtaagacac gacttatcgc cactggcagc agccactggt aacaggatta
     gcagagcgag gtatgtaggc ggtgctacag agttcttgaa gtggtggcct aactacggct
     acactagaag gacagtattt ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa
     gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt
     gcaagcagca gattacgcgc agaaaaaaag gatctcaaga agatcctttg atcttttcta
     cggggtctga cgctcagtgg aacgaaaact cacgttaagg gattttggtc atgagattat
     caaaaaggat cttcacctag atccttttaa attaaaaatg aagttttaaa tcaatctaaa
     gtatatatga gtaaacttgg tctgacagtt accaatgctt aatcagtgag gcacctatct
     cagcgatctg tctatttcgt tcatccatag ttgcctgact ccccgtcgtg tagataacta
     cgatacggga gggcttacca tctggcccca gtgctgcaat gataccgcga gacccacgct
     caccggctcc agatttatca gcaataaacc agccagccgg aagggccgag cgcagaagtg
     gtcctgcaac tttatccgcc tccatccagt ctattaattg ttgccgggaa gctagagtaa
     gtagttcgcc agttaatagt ttgcgcaacg ttgttgccat tgctgcaggc atcgtggtgt
     cacgctcgtc gtttggtatg gcttcattca gctccggttc ccaacgatca aggcgagtta
     catgatcccc catgttgtgc aaaaaagcgg ttagctcctt cggtcctccg atcgttgtca
     gaagtaagtt ggccgcagtg ttatcactca tggttatggc agcactgcat aattctctta
     ctgtcatgcc atccgtaaga tgcttttctg tgactggtga gtactcaacc aagtcattct
     gagaatagtg tatgcggcga ccgagttgct cttgcccggc gtcaacacgg gataataccg
     cgccacatag cagaacttta aaagtgctca tcattggaaa acgttcttcg gggcgaaaac
     tctcaaggat cttaccgctg ttgagatcca gttcgatgta acccactcgt gcacccaact
     gatcttcagc atcttttact ttcaccagcg tttctgggtg agcaaaaaca ggaaggcaaa
     atgccgcaaa aaagggaata agggcgacac ggaaatgttg aatactcata ctcttccttt
     ttcaatatta ttgaagcatt tatcagggtt attgtctcat gagcggatac atatttgaat
     gtatttagaa aaataaacaa ataggggttc cgcgcacatt tccccgaaaa gtgccacctg
     acgtctaaga aaccattatt atcatgacat taacctataa aaataggcgt atcacgaggc
     cctttcgtct tcaagaa
//