back Return to this vector's summary.
ID   PKO2       preliminary; circular DNA; SYN; 3755 BP.
XX
AC   L08924; VB0123; IG0076;
XX
DT   02-NOV-1992 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pKO-2 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-3755
RC   pKO-2
RA   Gilbert W.;
RT   "Obtained from VecBase 3.0";
RL   Unpublished (1991).
XX
RN   [2]
RC   pKO-II from pKO-1 & pPCV
RC   pKO-2 from pKO-II
RC   pKM-II from pKM-1 & pPCV
RC   pKM-2 from pKM-II
RA   De Boer H.A.;
RT   "A versatile plasmid system for the study of prokayotic
RT   transcription signals in Escherichia coli";
RL   Gene 30:251-255(1984).
XX
CC   These data and their annotation were supplied to GenBank by Will
CC   Gilbert under the auspices of the GenBank Currator Program.
CC
CC   Assembled from pKO1 and according to reference 1 by F. Pfeiffer.
CC   This is a promoter probe vector. The promoterless galK gene is
CC   used as selectable marker. Translationsal stop codons in all reading
CC   frames are present on a 11-bp oligonucleotide before the galK gene.
CC   Also, a polylinker was cloned before this gene.
CC
CC   pKO2 contains a 4-bp deletion not present in pKM2. However, in
CC   GenBank SYNPKO2 and SYNPKM2 have been mixed up. Thus, SYNPKM2 is given
CC   in the Parent section.
CC   NM (pKO-2)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli GALK-)(bacteria GalE-T-K-)
CC   CP ()
CC   FN (promoter analysis)
CC   SE (color red/white)
CC   PA (pKO-1)(EcoGalK)(pBR322)(pKM2)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 ClaI 4361bp 25..25
FT                   2. oligo ClaI-SacI-XhoI-XbaI-ClaI 21bp
FT                   \ cggagctctcgagtctagaat
FT                   -> pPCV 4382bp [unique ClaI, no tet promoter]
FT                   1. pKO-1 XmaI/SmaI 3980bp 312..312
FT                   S1 nuclease
FT                   remove PstI-HindIII 1043bp 3231..3980..294, 2937bp
FT                   2. pPCV PstI-HindIII 777bp, pBR322 3614..4361..30
FT                   -> pKO-II 3714bp
FT                   1. pKO-II ClaI-HindIII, pKO-1 1058..-..294
FT                   2. oligo ClaI-SmaI-HindIII 32bp
FT                   \ cgatcccgggaagcttaactaactaacagctt, stop codons
FT                   -> pKO-2 3755bp"
FT   CDS             0..0
FT                   /note="GEN lambda O gene"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   misc_feature    1..98
FT                   /note="synthetic oligonucleotide"
FT   misc_binding    1..61
FT                   /note="MCS EcoRI-SacI-XhoI-XbaI-ClaI-SmaI-HindIII"
FT   terminator      61..72
FT                   /note="TER synthetic stop-codons"
FT   misc_feature    91..448
FT                   /note="from lambda"
FT   CDS             98..1460
FT                   /note="GEN E. coli galactokinase gene (galK)"
FT   misc_feature    1461..3755
FT                   /note="from pBR322"
FT   CDS             2690..3478
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
XX
SQ   Sequence 3755 BP; 943 A; 968 C; 955 G; 889 T; 0 other;
     ttctcatgtt tgacagctta tcatcggagc tctcgagtct agaatcgatc ccgggaagct
     taactaacta acagcttact ccccatgcgc aataagggct gcacgcgcac ttttatccgc
     ctctgctgcg ctccgccacc gtacgtaaat ttatggttgg ttatgaaatg ctggcagaga
     cccagcgaga cctgaccgca gaacaggcag cagagcgttt gcgcgcagtc agcgatatcc
     attttcgcga atccggagtg taagaaatga gtctgaaaga aaaaacacaa tctctgtttg
     ccaacgcatt tggctaccct gccactcaca ccattcaggc gcctggccgc gtgaatttga
     ttggtgaaca caccgactac aacgacggtt tcgttctgcc ctgcgcgatt gattatcaaa
     ccgtgatcag ttgtgcacca cgcgatgacc gtaaagttcg cgtgatggca gccgattatg
     aaaatcagct cgacgagttt tccctcgatg cgcccattgt cgcacatgaa aactatcaat
     gggctaacta cgttcgtggc gtggtgaaac atctgcaact gcgtaacaac agcttcggcg
     gcgtggacat ggtgatcagc ggcaatgtgc cgacgggtgc cgggttaagt tcttccgctt
     cactggaagt cgcggtcgga accgtattgc agcagcttta tcatctgccg ctggacggcg
     cacaaatcgc gcttaacggt caggaagcag aaaaccagtt tgtaggctgt aactgcggga
     tcatggatca gctaatttcc gcgctcggca agaaagatca tgccttgctg atcgattgcc
     gctcactggg gaccaaagca gtttccatgc ccaaaggtgt ggctgtcgtc atcatcaaca
     gtaacttcaa acgtaccctg gttggcagcg aatacaacac ccgtcgtgaa cagtgcgaaa
     ccggtgcgcg tttcttccag cagccagccc tgcgtgatgt caccattgaa gagttcaacg
     ctgttgcgca tgaactggac ccgatcgtgg caaaacgcgt gcgtcatata ctgactgaaa
     acgcccgcac cgttgaagct gccagcgcgc tggagcaagg cgacctgaaa cgtatgggcg
     agttgatggc ggagtctcat gcctctatgc gcgatgattt cgaaatcacc gtgccgcaaa
     ttgacactct ggtagaaatc gtcaaagctg tgattggcga caaaggtggc gtacgcatga
     ccggcggcgg atttggcggc tgtatcgtcg cgctgatccc ggaagagctg gtgcctgccg
     cacagcaagc tgtcgctgaa caatatgaag caaaaacagg tattaaagag actttttacg
     tttgtaaacc atcacaagga gcaggacagt gctgaacgaa actcccgcac tggcacccga
     tggcagccgt accgactgtt ctgcctcgcg cgtttcggtg atgacggtga aaacctctga
     cacatgcagc tcccggagac ggtcacagct tgtctgtaag cggatgccgg gagcagacaa
     gcccgtcagg gcgcgtcagc gggtgttggc gggtgtcggg gcgcagccat gacccagtca
     cgtagcgata gcggagtgta tactggctta actatgcggc atcagagcag attgtactga
     gagtgcacca tatgcggtgt gaaataccgc acagatgcgt aaggagaaaa taccgcatca
     ggcgctcttc cgcttcctcg ctcactgact cgctgcgctc ggtcgttcgg ctgcggcgag
     cggtatcagc tcactcaaag gcggtaatac ggttatccac agaatcaggg gataacgcag
     gaaagaacat gtgagcaaaa ggccagcaaa aggccaggaa ccgtaaaaag gccgcgttgc
     tggcgttttt ccataggctc cgcccccctg acgagcatca caaaaatcga cgctcaagtc
     agaggtggcg aaacccgaca ggactataaa gataccaggc gtttccccct ggaagctccc
     tcgtgcgctc tcctgttccg accctgccgc ttaccggata cctgtccgcc tttctccctt
     cgggaagcgt ggcgctttct catagctcac gctgtaggta tctcagttcg gtgtaggtcg
     ttcgctccaa gctgggctgt gtgcacgaac cccccgttca gcccgaccgc tgcgccttat
     ccggtaacta tcgtcttgag tccaacccgg taagacacga cttatcgcca ctggcagcag
     ccactggtaa caggattagc agagcgaggt atgtaggcgg tgctacagag ttcttgaagt
     ggtggcctaa ctacggctac actagaagga cagtatttgg tatctgcgct ctgctgaagc
     cagttacctt cggaaaaaga gttggtagct cttgatccgg caaacaaacc accgctggta
     gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag aaaaaaagga tctcaagaag
     atcctttgat cttttctacg gggtctgacg ctcagtggaa cgaaaactca cgttaaggga
     ttttggtcat gagattatca aaaaggatct tcacctagat ccttttaaat taaaaatgaa
     gttttaaatc aatctaaagt atatatgagt aaacttggtc tgacagttac caatgcttaa
     tcagtgaggc acctatctca gcgatctgtc tatttcgttc atccatagtt gcctgactcc
     ccgtcgtgta gataactacg atacgggagg gcttaccatc tggccccagt gctgcaatga
     taccgcgaga cccacgctca ccggctccag atttatcagc aataaaccag ccagccggaa
     gggccgagcg cagaagtggt cctgcaactt tatccgcctc catccagtct attaattgtt
     gccgggaagc tagagtaagt agttcgccag ttaatagttt gcgcaacgtt gttgccattg
     ctgcaggcat cgtggtgtca cgctcgtcgt ttggtatggc ttcattcagc tccggttccc
     aacgatcaag gcgagttaca tgatccccca tgttgtgcaa aaaagcggtt agctccttcg
     gtcctccgat cgttgtcaga agtaagttgg ccgcagtgtt atcactcatg gttatggcag
     cactgcataa ttctcttact gtcatgccat ccgtaagatg cttttctgtg actggtgagt
     actcaaccaa gtcattctga gaatagtgta tgcggcgacc gagttgctct tgcccggcgt
     caacacggga taataccgcg ccacatagca gaactttaaa agtgctcatc attggaaaac
     gttcttcggg gcgaaaactc tcaaggatct taccgctgtt gagatccagt tcgatgtaac
     ccactcgtgc acccaactga tcttcagcat cttttacttt caccagcgtt tctgggtgag
     caaaaacagg aaggcaaaat gccgcaaaaa agggaataag ggcgacacgg aaatgttgaa
     tactcatact cttccttttt caatattatt gaagcattta tcagggttat tgtctcatga
     gcggatacat atttgaatgt atttagaaaa ataaacaaat aggggttccg cgcacatttc
     cccgaaaagt gccacctgac gtctaagaaa ccattattat catgacatta acctataaaa
     ataggcgtat cacgaggccc tttcgtcttc aagaa
//