back Return to this vector's summary.
ID   PKONEO     preliminary; circular DNA; SYN; 6284 BP.
XX
AC   IG9957;
XX
DT   01-JUL-1995 (Rel. 11, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli phagemid vector pKO-neo - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pSV-SPORT1 from pKO-neo & pSPORT1
RA   Crouse J.E.;
RT   "Plasmid pSV-SPORT1";
RL   GibcoBRL Catalogue 93:7p16-7p17(1993).
RL   Crouse J.E., Life Technologies Inc., Gaithersburg MD 20877.
XX
RN   [2]
RC   pSV-SPORT1 from pKO-neo & pSPORT1
RA   D'Alessio J.M.;
RT   ;
RL   Unpublished (1994).
RL   Life Technologies, Inc. Catalogue.
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   NM (pKO-neo)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (phagemid)
CC   SP ()
CC   HO (E.coli DH5alpha)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pBR322)(SV40)(Tn5)(lambda)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 remove small EcoRI-HindIII 31bp
FT                   \ 4360..4361..30, 4330bp
FT                   2. SV40 HindIII-PvuII 344bp 5172..5243..273,
FT                   \ ori/early promoter
FT                   3. E. coli EcoRI-AluI 99bp, lacUV5 promoter-oper
FT                   \ aattctcactcattaggcaccccaggctttacactttatgcttccggctc
FT                   \ gtataatgtgtggaattgtgagcggataacaatttcacacaggaaacag
FT                   -> plasmid 4769bp
FT                   1. plasmid BamHI-HindIII 4423bp, SV40 ori/early prom
FT                   \ pBR322 376..4360..-..- [remove 346bp]
FT                   2. SV40 MboI-MboI 610bp 4101..4711, intron [615bp]
FT                   Klenow:Klenow
FT                   HindIII linker 10bp nnaagcttnn:HindIII linker 10bp
FT                   \ nnaagcttnn
FT                   HindIII-HindIII 615bp
FT                   HinfI-HindIII 143bp 4570..4713, [147bp]
FT                   \ SV40 small t intron
FT                   3. SV40 BamHI-HinfI 291bp 2534..2825, polyA [289bp]
FT                   -> pko 4857bp
FT                   1. Tn5 HindIII-BamHI 1861bp 1196..3057,
FT                   \ neo/kan gene with BglII
FT                   -> plasmid2
FT                   1. pko remove HindIII-BamHI, 4423bp
FT                   2. plasmid2 HindIII-BamHI 1861bp 1196..3057,
FT                   \ neo/kan gene with BglII
FT                   -> pKO-neo 6284bp"
FT   -               1..3984
FT                   /note="pBR322 376..4359 3984bp
FT                   EcoRI = G^AATTC
FT                   \         aattc..."
FT   -               3985..4083
FT                   /note="99bp
FT                   \ aattctcactcattaggcaccccaggctttacactttatgcttccggctc
FT                   \ gtataatgtgtggaattgtgagcggataacaatttcacacaggaaacag
FT                   \ ...aaacag
FT                   AluI =   AG^CT
FT                   PvuII = CAG^CTG"
FT   -               4084..4423
FT                   /note="SV40 5176..5243..272 340bp complement
FT                   HindIII = A^AGCTT"
FT   -               4424..6284
FT                   /note="Tn5 1196..3056 1861bp
FT                   BamHI = G^GATCC"
FT   rep_origin      0..0
FT                   /note="ORI SV40"
FT   CDS             0..0
FT                   /note="GEN SV40 small t-intron region"
FT   misc_feature    0..0
FT                   /note="SPL SV40 72 base insertion"
FT   polyA_signal    0..0
FT                   /note="PLA SV40 early genes"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   promoter        0..0
FT                   /note="PRO E. coli lacUV5 gene"
XX
SQ   Sequence 6284 BP; 1370 A; 1756 C; 1747 G; 1411 T; 0 other;
     gatcctctac gccggacgca tcgtggccgg catcaccggc gccacaggtg cggttgctgg
     cgcctatatc gccgacatca ccgatgggga agatcgggct cgccacttcg ggctcatgag
     cgcttgtttc ggcgtgggta tggtggcagg ccccgtggcc gggggactgt tgggcgccat
     ctccttgcat gcaccattcc ttgcggcggc ggtgctcaac ggcctcaacc tactactggg
     ctgcttccta atgcaggagt cgcataaggg agagcgtcga ccgatgccct tgagagcctt
     caacccagtc agctccttcc ggtgggcgcg gggcatgact atcgtcgccg cacttatgac
     tgtcttcttt atcatgcaac tcgtaggaca ggtgccggca gcgctctggg tcattttcgg
     cgaggaccgc tttcgctgga gcgcgacgat gatcggcctg tcgcttgcgg tattcggaat
     cttgcacgcc ctcgctcaag ccttcgtcac tggtcccgcc accaaacgtt tcggcgagaa
     gcaggccatt atcgccggca tggcggccga cgcgctgggc tacgtcttgc tggcgttcgc
     gacgcgaggc tggatggcct tccccattat gattcttctc gcttccggcg gcatcgggat
     gcccgcgttg caggccatgc tgtccaggca ggtagatgac gaccatcagg gacagcttca
     aggatcgctc gcggctctta ccagcctaac ttcgatcact ggaccgctga tcgtcacggc
     gatttatgcc gcctcggcga gcacatggaa cgggttggca tggattgtag gcgccgccct
     ataccttgtc tgcctccccg cgttgcgtcg cggtgcatgg agccgggcca cctcgacctg
     aatggaagcc ggcggcacct cgctaacgga ttcaccactc caagaattgg agccaatcaa
     ttcttgcgga gaactgtgaa tgcgcaaacc aacccttggc agaacatatc catcgcgtcc
     gccatctcca gcagccgcac gcggcgcatc tcgggcagcg ttgggtcctg gccacgggtg
     cgcatgatcg tgctcctgtc gttgaggacc cggctaggct ggcggggttg ccttactggt
     tagcagaatg aatcaccgat acgcgagcga acgtgaagcg actgctgctg caaaacgtct
     gcgacctgag caacaacatg aatggtcttc ggtttccgtg tttcgtaaag tctggaaacg
     cggaagtcag cgccctgcac cattatgttc cggatctgca tcgcaggatg ctgctggcta
     ccctgtggaa cacctacatc tgtattaacg aagcgctggc attgaccctg agtgattttt
     ctctggtccc gccgcatcca taccgccagt tgtttaccct cacaacgttc cagtaaccgg
     gcatgttcat catcagtaac ccgtatcgtg agcatcctct ctcgtttcat cggtatcatt
     acccccatga acagaaatcc cccttacacg gaggcatcag tgaccaaaca ggaaaaaacc
     gcccttaaca tggcccgctt tatcagaagc cagacattaa cgcttctgga gaaactcaac
     gagctggacg cggatgaaca ggcagacatc tgtgaatcgc ttcacgacca cgctgatgag
     ctttaccgca gctgcctcgc gcgtttcggt gatgacggtg aaaacctctg acacatgcag
     ctcccggaga cggtcacagc ttgtctgtaa gcggatgccg ggagcagaca agcccgtcag
     ggcgcgtcag cgggtgttgg cgggtgtcgg ggcgcagcca tgacccagtc acgtagcgat
     agcggagtgt atactggctt aactatgcgg catcagagca gattgtactg agagtgcacc
     atatgcggtg tgaaataccg cacagatgcg taaggagaaa ataccgcatc aggcgctctt
     ccgcttcctc gctcactgac tcgctgcgct cggtcgttcg gctgcggcga gcggtatcag
     ctcactcaaa ggcggtaata cggttatcca cagaatcagg ggataacgca ggaaagaaca
     tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt
     tccataggct ccgcccccct gacgagcatc acaaaaatcg acgctcaagt cagaggtggc
     gaaacccgac aggactataa agataccagg cgtttccccc tggaagctcc ctcgtgcgct
     ctcctgttcc gaccctgccg cttaccggat acctgtccgc ctttctccct tcgggaagcg
     tggcgctttc tcatagctca cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca
     agctgggctg tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta tccggtaact
     atcgtcttga gtccaacccg gtaagacacg acttatcgcc actggcagca gccactggta
     acaggattag cagagcgagg tatgtaggcg gtgctacaga gttcttgaag tggtggccta
     actacggcta cactagaagg acagtatttg gtatctgcgc tctgctgaag ccagttacct
     tcggaaaaag agttggtagc tcttgatccg gcaaacaaac caccgctggt agcggtggtt
     tttttgtttg caagcagcag attacgcgca gaaaaaaagg atctcaagaa gatcctttga
     tcttttctac ggggtctgac gctcagtgga acgaaaactc acgttaaggg attttggtca
     tgagattatc aaaaaggatc ttcacctaga tccttttaaa ttaaaaatga agttttaaat
     caatctaaag tatatatgag taaacttggt ctgacagtta ccaatgctta atcagtgagg
     cacctatctc agcgatctgt ctatttcgtt catccatagt tgcctgactc cccgtcgtgt
     agataactac gatacgggag ggcttaccat ctggccccag tgctgcaatg ataccgcgag
     acccacgctc accggctcca gatttatcag caataaacca gccagccgga agggccgagc
     gcagaagtgg tcctgcaact ttatccgcct ccatccagtc tattaattgt tgccgggaag
     ctagagtaag tagttcgcca gttaatagtt tgcgcaacgt tgttgccatt gctgcaggca
     tcgtggtgtc acgctcgtcg tttggtatgg cttcattcag ctccggttcc caacgatcaa
     ggcgagttac atgatccccc atgttgtgca aaaaagcggt tagctccttc ggtcctccga
     tcgttgtcag aagtaagttg gccgcagtgt tatcactcat ggttatggca gcactgcata
     attctcttac tgtcatgcca tccgtaagat gcttttctgt gactggtgag tactcaacca
     agtcattctg agaatagtgt atgcggcgac cgagttgctc ttgcccggcg tcaacacggg
     ataataccgc gccacatagc agaactttaa aagtgctcat cattggaaaa cgttcttcgg
     ggcgaaaact ctcaaggatc ttaccgctgt tgagatccag ttcgatgtaa cccactcgtg
     cacccaactg atcttcagca tcttttactt tcaccagcgt ttctgggtga gcaaaaacag
     gaaggcaaaa tgccgcaaaa aagggaataa gggcgacacg gaaatgttga atactcatac
     tcttcctttt tcaatattat tgaagcattt atcagggtta ttgtctcatg agcggataca
     tatttgaatg tatttagaaa aataaacaaa taggggttcc gcgcacattt ccccgaaaag
     tgccacctga cgtctaagaa accattatta tcatgacatt aacctataaa aataggcgta
     tcacgaggcc ctttcgtctt caagaattct cactcattag gcaccccagg ctttacactt
     tatgcttccg gctcgtataa tgtgtggaat tgtgagcgga taacaatttc acacaggaaa
     cagctgtgga atgtgtgtca gttagggtgt ggaaagtccc caggctcccc agcaggcaga
     agtatgcaaa gcatgcatct caattagtca gcaaccaggt gtggaaagtc cccaggctcc
     ccagcaggca gaagtatgca aagcatgcat ctcaattagt cagcaaccat agtcccgccc
     ctaactccgc ccatcccgcc cctaactccg cccagttccg cccattctcc gccccatggc
     tgactaattt tttttattta tgcagaggcc gaggccgcct cggcctctga gctattccag
     aagtagtgag gaggcttttt tggaggccta ggcttttgca aaaagcttca cgctgccgca
     agcactcagg gcgcaagggc tgctaaagga agcggaacac gtagaaagcc agtccgcaga
     aacggtgctg accccggatg aatgtcagct actgggctat ctggacaagg gaaaacgcaa
     gcgcaaagag aaagcaggta gcttgcagtg ggcttacatg gcgatagcta gactgggcgg
     ttttatggac agcaagcgaa ccggaattgc cagctggggc gccctctggt aaggttggga
     agccctgcaa agtaaactgg atggctttct tgccgccaag gatctgatgg cgcaggggat
     caagatctga tcaagagaca ggatgaggat cgtttcgcat gattgaacaa gatggattgc
     acgcaggttc tccggccgct tgggtggaga ggctattcgg ctatgactgg gcacaacaga
     caatcggctg ctctgatgcc gccgtgttcc ggctgtcagc gcaggggcgc ccggttcttt
     ttgtcaagac cgacctgtcc ggtgccctga atgaactgca ggacgaggca gcgcggctat
     cgtggctggc cacgacgggc gttccttgcg cagctgtgct cgacgttgtc actgaagcgg
     gaagggactg gctgctattg ggcgaagtgc cggggcagga tctcctgtca tctcaccttg
     ctcctgccga gaaagtatcc atcatggctg atgcaatgcg gcggctgcat acgcttgatc
     cggctacctg cccattcgac caccaagcga aacatcgcat cgagcgagca cgtactcgga
     tggaagccgg tcttgtcgat caggatgatc tggacgaaga gcatcagggg ctcgcgccag
     ccgaactgtt cgccaggctc aaggcgcgca tgcccgacgg cgaggatctc gtcgtgaccc
     atggcgatgc ctgcttgccg aatatcatgg tggaaaatgg ccgcttttct ggattcatcg
     actgtggccg gctgggtgtg gcggaccgct atcaggacat agcgttggct acccgtgata
     ttgctgaaga gcttggcggc gaatgggctg accgcttcct cgtgctttac ggtatcgccg
     ctcccgattc gcagcgcatc gccttctatc gccttcttga cgagttcttc tgagcgggac
     tctggggttc gaaatgaccg accaagcgac gcccaacctg ccatcacgag atttcgattc
     caccgccgcc ttctatgaaa ggttgggctt cggaatcgtt ttccgggacg ccggctggat
     gatcctccag cgcggggatc tcatgctgga gttcttcgcc caccccgggc tcgatcccct
     cgcgagttgg ttcagctgct gcctgaggct ggacgacctc gcggagttct accggcagtg
     caaatccgtc ggcatccagg aaaccagcag cggctatccg cgcatccatg cccccgaact
     gcaggagtgg ggaggcacga tggccgcttt ggtcgacccg gacgggacgc tcctgcgcct
     gatacagaac gaattgcttg caggcatctc atgagtgtgt cttcccgttt tccgcctgag
     gtcactgcgt ggatggagcg ctggcgcctg ctgcgcgacg gcgagctgct caccacccac
     tcgagctgga tacttcccgt ccgccagggg gacatgccgg cgatgctgaa ggtcgcgcgc
     attcccgatg aagaggccgg ttaccgcctg ttgacctggt gggacgggca gggcgccgcc
     cgagtcttcg cctcggcggc gggcgctctg ctcatggagc gcgcgtccgg ggccggggac
     cttgcacaga tagcgtggtc cggccaggac gacgaggctt gcag
//