back Return to this vector's summary.
ID   PKSM710    preliminary; circular DNA; SYN; 5071 BP.
XX
AC   U04893;
XX
DT   03-FEB-1994 (Rel. 8, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli phagemid vector pKSM710 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pKSM710, pKSM711, pKSM713, pKSM715 from pBR322 & phage T7 & phage fd
RA   Maneewannakul S., Maneewannakul K., Ippen-Ihler K.;
RT   "The pKSM710 vector cassette provides tightly regulated lac and
RT   T7lac promoters and strategies for manipulating N-terminal
RT   protein sequences";
RL   Plasmid 31:300-307(1994).
XX
RN   [2]
RC   pKSM710
RA   Maneewannakul S.;
RT   ;
RL   Submitted (06-JAN-1994) by:
RL   Maneewannakul S., Harvard University,
RL   CDB, 16 Divinity Avenue, Cambridge MA 02138, USA.
XX
CC   NCBI gi: 450834
CC   NM (pKSM710)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (phagemid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pBR322)(T7)(fd)
CC   BR (pKSM715)(pKSM711)(pKSM713)
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 4361bp, ori
FT                   2. lambda, pL
FT                   3. T7, promoter
FT                   4. E. coli EcoRI-AluI 99bp, lacUV5 promoter-oper
FT                   \ aattctcactcattaggcaccccaggctttacactttatgcttccggctc
FT                   \ gtataatgtgtggaattgtgagcggataacaatttcacacaggaaacag
FT                   5. T7, terminator
FT                   6. E. coli, rrnB T1 T2 terminators
FT                   7. Tn9 TaqI-TaqI 773bp 215..988, cat gene/#V00622
FT                   -> pKSM710 5071bp"
FT   terminator      24..70
FT                   /note="TER"
FT   terminator      134..180
FT                   /note="TER"
FT   rep_origin      313..768
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   rep_origin      complement(921..1515)
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   terminator      complement(2720..2774)
FT                   /note="TER"
FT   promoter        3881..3910
FT                   /note="PRO bacteriophage lambda PL"
FT   promoter        4109..4125
FT                   /note="PRO bacteriophage T7"
FT   promoter        4286..4315
FT                   /note="PRO E. coli lacUV5 gene"
FT   terminator      4698..4739
FT                   /note="TER bacteriophage T7 terminator; T-phi"
FT   terminator      4796..4839
FT                   /note="TER E. coli rrnB T1 terminator"
FT   terminator      4970..4999
FT                   /note="TER E. coli rrnB T2 terminator"
FT   CDS             complement(1686..2546)
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp);
FT                   NCBI gi: 450835"
FT   CDS             complement(2860..3520)
FT                   /note="ANT E. coli chloramphenicol acetyltransferase
FT                   gene (cat); chloramphenicol resistance gene (cmr/cml);
FT                   chloramphenicol acetyl methylase; NCBI gi: 450836"
XX
SQ   Sequence 5071 BP; 1332 A; 1233 C; 1169 G; 1337 T; 0 other;
     aattcacctc gaaagcaagc tgataaaccg atacaattaa aggctccttt tggagccttt
     ttttttggag attttcaacg tgaaaaaatt attattcgca attccaagct aattcacctc
     gaaagcaagc tgataaaccg atacaattaa aggctccttt tggagccttt ttttttggag
     attttcaacg tgaaaaaatt attattcgca attccaagct ctgcctcgcg cgtttcggtg
     atgacggtga aaacctctga cacatgcagc tcccggagac ggtcacagct tgtctgtaag
     cggatgcaga tcacgcgccc tgtagcggcg cattaagcgc ggcgggtgtg gtggttacgc
     gcagcgtgac cgctacactt gccagcgccc tagcgcccgc tcctttcgct ttcttccctt
     cctttctcgc cacgttcgcc agctttcccc gtcaagctct aaatcggggg ctccctttag
     ggttccgatt tagtgcttta cggcacctcg accccaaaaa acttgattag ggtgatggtt
     cacgtagtgg gccatcgccc tgatagacgg tttttcgccc tttgacgttg gagtccacgt
     tctttaatag tggactcttg ttccaaactg gaacaacact caaccctatc tcggtctatt
     cttttgattt ataagggatt ttgccgattt cggcctattg gttaaaaaat gagctgattt
     aacaaaaatt taacgcgaat tttaacaaaa tattaacgtt tacaatttga tctgcgctcg
     gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg cggtaatacg gttatccaca
     gaatcagggg ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa ggccaggaac
     cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc gcccccctga cgagcatcac
     aaaaatcgac gctcaagtca gaggtggcga aacccgacag gactataaag ataccaggcg
     tttccccctg gaagctccct cgtgcgctct cctgttccga ccctgccgct taccggatac
     ctctccgcct ttctcccttc gggaagcgtg gcgctttctc aatgctcacg ctgtaggtat
     ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag
     cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt aagacacgac
     ttatcgccac tggcagcagc cactggtaac aggattagca gagcgaggta tgtaggcggt
     gctacagagt tcttgaagtg gtggcctaac tacggctaca ctagaaggac agtatttggt
     atctgcgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc ttgatccggc
     aaacaaacca ccgctggtag cggtggtttt tttgtttgca agcagcagat tacgcgcaga
     aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc tgactggaac
     gaaaactcac gttaagggat tttggtcatg agattatcaa aaaggatctt cacctagatc
     cttttaaatt aaaaatgaag ttttaaatca atctaaagta tatatgagta aacttggtct
     cacagttacc aatgcttaat cagtgaggca cctatctcag cgatctgtct atttcgttca
     tccatagttg cctgactccc cgtcgtgtag ataactacga tacgggaggg cttaccatct
     ggccccagtg ctgcaatgat accgcgagac ccacgctcac cggctccaga tttatcagca
     ataaaccagc cagccggaag ggccgagcgc agaagtggtc ctgcaacttt atccgcctcc
     atccagtcta ttaattgttg ccgggaagct agagtaagta gttcgccagt taatagtttg
     cgcaacgttg ttgccattgc tgcaggcatc gtggtgtcac gctcgtcgtt tggtatggct
     tcattcagct ccggttccca acgatcaagg cgagttacat gatcccccat gttgtgcaaa
     aaagcggtta gctccttcgg tcctccgatc gttgtcagaa gtaagttggc cgcagtgtta
     tcactcatgg ttatggcagc actgcataat tctcttactg tcatgccatc cgtaagatgc
     ttttctgtga ctggtgagta ctcaaccaag tcattctgag aatagtgtat gcggcgaccg
     agttgctctt gcccggcgtc aacacgggat aataccgcgc cacatagcag aactttaaaa
     gtgctcatca ttggaaaacg ttcttcgggg cgaaaactct caaggatctt accgctgttg
     agatccagtt cgatgtaacc cactcgtgca cccaactgat cttcagcatc ttttactttc
     accagcgttt ctgggtgagc aaaaacagga aggcaaaatg ccgcaaaaaa gggaataagg
     gcgacacgga aatgttgaat actcatactc ttcctttttc aatattattg aagcagacag
     ttttattgtt catgatgata tatttttatc ttgtgcaatg taacatcaga gattttgaga
     aacaacgtgg ctttgttgaa taaatcgaac ttttgctgag ttgactcccc gcgcgcgatg
     ggtcgaattt gctttcgaaa aaaaagcccg ctcattaggc gggctaaaaa aaagcccgct
     cattaggcgg gctcgaattt ctgccattca tccgcttatt atcacttatt caggcgtagc
     aaccaggcgt ttaagggcac caataagtgc cttaaaaaaa ttacgccccg ccctgccact
     catcgcagta ctgttgtaat tcattaagca ttctgccgac atggaagcca tcacagacgg
     catgatgaac ctgaatcgcc agcggcatca gcaccttgtc gccttgcgta taatatttgc
     ccatagtgaa aacgggggcg aagaagttgt ccatattcgc cacgtttaaa tcaaaactgg
     tgaaactcac ccagggattg gctgagacga aaaacatatt ctcaataaac cctttaggga
     aataggccag gttttcaccg taacacgcca catcttgcga atatatgtgt agaaactgcc
     ggaaatcgtc gtggtattca ctccagagcg atgaaaacgt ttcagtttgc tcatggaaaa
     cggtgtaaca agggtgaaca ctatcccata tcaccagctc accgtctttc attgccatac
     gaaattccgg atgagcattc atcaggcggg caagaatgtg aataaaggcc ggataaaact
     tgtgcttatt tttctttacg gtctttaaaa aggccgtaat atccagctga acggtctggt
     tataggtaca ttgagcaact gactgaaatg cctcaaaatg ttctttacga tgccattggg
     atatatcaac ggtggtatat ccagtgattt ttttctccat tttagcttcc ttagctcctg
     aaaatctcga taactcaaaa aatacgcccg gtagtgatct tatttcatta tggtgaaagt
     tggaacctct tacgtgccga tcaacgtctc attttcgcca aaagttggcc cagggcttcc
     cggtatcaac agggacacca ggatttattt attctgcgaa gtgatcttcc gtcacaggta
     tttattcgaa gacgaaaggg catcgcgcgc ggggaattgg ccacgatgcg tccggcgtag
     aggatctctc acctaccaaa caatgccccc ctgcaaaaaa taaattcata taaaaaacat
     atagataacc atctgcggtg ataaattatc tctggcggtg ttgacataaa taccactggc
     ggtgatactg agcacatcag caggacgcac tgaccaccat gaaggtgacg ctcttaaaat
     taagccctga agaagggcag cattcaaagc agaaggcttt ggggtgtgtg atacgaaacg
     aagcattgga attctacaac ttgcttggat tcctacaaag aagcagcaat tttcagtgtc
     agaagtcgag atctcgatcc cgcgaaatta atacgactca ctatagggga attgtgagcg
     gataacaatt cccctctagc gcgtattcag gctgaccctg cgcgctgcgc agggctttat
     tgattccatt tttacactga tgaatgttcc gttgcgctgc ccggattaca ggggaattaa
     ttctcactca ttaggcaccc caggctttac actttatgct tccggctcgt ataatgtgtg
     gaattgtgag cggataacaa tttcacacag gaaacagaat taattcttac acttagttaa
     attgctaact ttatagatta caaaacttag gagggttttt accatggggg atcccaagct
     tcttctagag gtaccgcatg cgatatcgag ctctcccggg aattcactgg ccgtcgtttt
     acaacgtcgt gactgggaaa accctggcgt tacccaactt aatcgccttg cagcacatcc
     ccctttcgcc agctggcgta atagcgaaga ggcccgcacc gatcgccctt cccaacagtt
     gcgcagcctg atccggctgc taacaaagcc cgaaaggaag ctgagttggc tgctgccacc
     gctgagcaat aactagcata accccttggg gcctctaaac gggtcttgag gggttttttg
     ctgaaaggag gaactatatc cggatatgcg agagtaggga actgccaggc atcaaataaa
     acgaaaggct cagtcgaaag actgggcctt tcgttttatc tgttgtttgt cggtgaacgc
     tctcctgagt aggacaaatc cgccgggagc ggatttgaac gttgcgaagc aacggcccgg
     agggtggcgg gcaggacgcc cgccataaac tgccaggcat caaattaagc agaaggccat
     cctgacggat ggcctttttg cgtttctaca aactcttttg tttatttttc taaatacatt
     caaatatgta tccgctcatg ctagaggtcg a
//