back Return to this vector's summary.
ID   PKSM711    preliminary; circular DNA; SYN; 3741 BP.
XX
AC   U04894;
XX
DT   03-FEB-1994 (Rel. 8, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli phagemid vector pKSM711 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-3741
RC   pKSM710, pKSM711, pKSM713, pKSM715 from pBR322 & phage T7 & phage fd
RA   Maneewannakul S., Maneewannakul K., Ippen-Ihler K.;
RT   "The pKSM710 vector cassette provides tightly regulated lac and
RT   T7lac promoters and strategies for manipulating N-terminal
RT   protein sequences";
RL   Plasmid 31:300-307(1994).
XX
RN   [2]
RP   1-3741
RC   pKSM711
RA   Maneewannakul S.;
RT   ;
RL   Submitted (06-JAN-1994) by:
RL   Maneewannakul S., Harvard University,
RL   CDB, 16 Divinity Avenue, Cambridge MA 02138, USA.
XX
CC   NCBI gi: 450837
CC   NM (pKSM711)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (phagemid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pBR322)(T7)(fd)
CC   BR (pKSM710)(pKSM715)(pKSM713)
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322, ori
FT                   2. lambda, pL
FT                   3. T7, promoter
FT                   4. E. coli EcoRI-AluI 99bp, lacUV5 promoter-oper
FT                   \ aattctcactcattaggcaccccaggctttacactttatgcttccggctc
FT                   \ gtataatgtgtggaattgtgagcggataacaatttcacacaggaaacag
FT                   5. T7, terminator
FT                   6. E. coli, rrnB T1 T2 temrinators
FT                   7. Tn9 TaqI-TaqI 773bp 215..988, cat gene/#V00622
FT                   -> pKSM711 3741bp"
FT   promoter        20..36
FT                   /note="PRO bacteriophage T7 promoter"
FT   promoter        197..226
FT                   /note="PRO E. coli lacUV5 promoter"
FT   terminator      609..650
FT                   /note="TER bacteriophage T7 terminator; T-phi"
FT   terminator      707..750
FT                   /note="TER E. coli rrnBT1 terminator"
FT   terminator      881..910
FT                   /note="TER E. coli rrnBT2 terminator"
FT   terminator      1006..1052
FT                   /note="TER bacteriophage fd terminator"
FT   terminator      1116..1162
FT                   /note="TER bacteriophage fd terminator"
FT   rep_origin      1295..1750
FT                   /note="ORI bacteriophage f1 origin"
FT   rep_origin      complement(1903..2497)
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             335..607
FT                   /note="GEN E. coli beta-galactosidase gene (lacZ)
FT                   alpha peptide (lacZM15); NCBI gi: 450838"
FT   CDS             complement(2592..3386)
FT                   /note="ANT E. coli kanamycin resistance gene (kan);
FT                   from Tn5; aminoglycoside phosphotransferase;
FT                   NCBI gi: 450839"
XX
SQ   Sequence 3741 BP; 872 A; 1028 C; 930 G; 911 T; 0 other;
     gatctcgatc ccgcgaaatt aatacgactc actatagggg aattgtgagc ggataacaat
     tcccctctag cgcgtattca ggctgaccct gcgcgctgcg cagggcttta ttgattccat
     ttttacactg atgaatgttc cgttgcgctg cccggattac aggggaatta attctcactc
     attaggcacc ccaggcttta cactttatgc ttccggctcg tataatgtgt ggaattgtga
     gcggataaca atttcacaca ggaaacagaa ttaattctta cacttagtta aattgctaac
     tttatagatt acaaaactta ggagggtttt taccatgggg gatcccaagc ttcttctaga
     ggtaccgcat gcgatatcga gctctcccgg gaattcactg gccgtcgttt tacaacgtcg
     tgactgggaa aaccctggcg ttacccaact taatcgcctt gcagcacatc cccctttcgc
     cagctggcgt aatagcgaag aggcccgcac cgatcgccct tcccaacagt tgcgcagcct
     gatccggctg ctaacaaagc ccgaaaggaa gctgagttgg ctgctgccac cgctgagcaa
     taactagcat aaccccttgg ggcctctaaa cgggtcttga ggggtttttt gctgaaagga
     ggaactatat ccggatatgc gagagtaggg aactgccagg catcaaataa aacgaaaggc
     tcagtcgaaa gactgggcct ttcgttttat ctgttgtttg tcggtgaacg ctctcctgag
     taggacaaat ccgccgggag cggatttgaa cgttgcgaag caacggcccg gagggtggcg
     ggcaggacgc ccgccataaa ctgccaggca tcaaattaag cagaaggcca tcctgacgga
     tggccttttt gcgtttctac aaactctttt gtttattttt ctaaatacat tcaaatatgt
     atccgctcat gctagaggtc gaaattcacc tcgaaagcaa gctgataaac cgatacaatt
     aaaggctcct tttggagcct ttttttttgg agattttcaa cgtgaaaaaa ttattattcg
     caattccaag ctaattcacc tcgaaagcaa gctgataaac cgatacaatt aaaggctcct
     tttggagcct ttttttttgg agattttcaa cgtgaaaaaa ttattattcg caattccaag
     ctctgcctcg cgcgtttcgg tgatgacggt gaaaacctct gacacatgca gctcccggag
     acggtcacag cttgtctgta agcggatgca gatcacgcgc cctgtagcgg cgcattaagc
     gcggcgggtg tggtggttac gcgcagcgtg accgctacac ttgccagcgc cctagcgccc
     gctcctttcg ctttcttccc ttcctttctc gccacgttcg ccagctttcc ccgtcaagct
     ctaaatcggg ggctcccttt agggttccga tttagtgctt tacggcacct cgaccccaaa
     aaacttgatt agggtgatgg ttcacgtagt gggccatcgc cctgatagac ggtttttcgc
     cctttgacgt tggagtccac gttctttaat agtggactct tgttccaaac tggaacaaca
     ctcaacccta tctcggtcta ttcttttgat ttataaggga ttttgccgat ttcggcctat
     tggttaaaaa atgagctgat ttaacaaaaa tttaacgcga attttaacaa aatattaacg
     tttacaattt gatctgcgct cggtcgttcg gctgcggcga gcggtatcag ctcactcaaa
     ggcggtaata cggttatcca cagaatcagg ggataacgca ggaaagaaca tgtgagcaaa
     aggccagcaa aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt tccataggct
     ccgcccccct gacgagcatc acaaaaatcg acgctcaagt cagaggtggc gaaacccgac
     aggactataa agataccagg cgtttccccc tggaagctcc ctcgtgcgct ctcctgttcc
     gaccctgccg cttaccggat acctctccgc ctttctccct tcgggaagcg tggcgctttc
     tcaatgctca cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca agctgggctg
     tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta tccggtaact atcgtcttga
     gtccaacccg gtaagacacg acttatcgcc actggcagca gccactggta acaggattag
     cagagcgagg tatgtaggcg gtgctacaga gttcttgaag tggtggccta actacggcta
     cactagaagg acagtatttg gtatctgcgc tctgctgaag ccagttacct tcggaaaaag
     agttggtagc tcttgatccg gcaaacaaac caccgctggt agcggtggtt tttttgtttg
     caagcagcag attacgcgca gaaaaaaagg atctcaagaa gatcctttga tcttttctac
     ggggtctgac gctgactgga acgaaaactc acgttaaggg attttggtca tgtcgaaccc
     cagagtcccg ctcagaagaa ctcgtcaaga aggcgataga aggcgatgcg ctgcgaatcg
     ggagcggcga taccgtaaag cacgaggaag cggtcagccc attcgccgcc aagctcttca
     gcaatatcac gggtagccaa cgctatgtcc tgatagcggt ccgccacacc cagccggcca
     cagtcgatga atccagaaaa gcggccattt tccaccatga tattcggcaa gcaggcatcg
     ccatgggtca cgacgagatc ctcgccgtcg ggcatgcgcg ccttgagcct ggcgaacagt
     tcggctggcg cgagcccctg atgctcttcg tccagatcat cctgatcgac aagaccggct
     tccatccgag tacgtgctcg ctcgatgcga tgtttcgctt ggtggtcgaa tgggcaggta
     gccggatcaa gcgtatgcag ccgccgcatt gcatcagcca tgatggatac tttctcggca
     ggagcaaggt gagatgacag gagatcctgc cccggcactt cgcccaatag cagccagtcc
     cttcccgctt cagtgacaac gtcgagcaca gctgcgcaag gaacgcccgt cgtggccagc
     cacgatagcc gcgctgcctc gtcctgcagt tcattcaggg caccggacag gtcggtcttg
     acaaaaagaa ccgggcgccc ctgcgctgac agccggaaca cggcggcatc agagcagccg
     attgtctgtt gtgcccagtc atagccgaat agcctctcca cccaagcggc cggagaacct
     gcgtgcaatc catcttgttc aatcatgcga aacgatcctc atcctgtctc ttgatcagat
     cttgatcccc tgcgccatca gatccttggc ggcaagaaag ccatccagtt tactttgcag
     ggcttcccaa ccttaccaga gggcgcccca gctggcaatt ccggttcgct tgctgtccat
     aaaaccgccc agtctagcta tcgccatgta agcccactgc aagctacctg ctttctcttt
     gcgcttcgct tttcccttgt ccagatagcc cagtagctga cattcatccg gggtcagcac
     cgtttctgcg gactggcttt ctacgtgttc cgcttccttt agcagccctt gcgccctgag
     tgcttgcggc agcgtgaagc t
//