back Return to this vector's summary.
ID   PKSM715    preliminary; circular DNA; SYN; 5041 BP.
AC   U04896;
DT   03-FEB-1994 (Rel. 8, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
DE   E. coli phagemid vector pKSM715 - complete.
KW   cloning vector.
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
RN   [1]
RP   1-5041
RC   pKSM710, pKSM711, pKSM713, pKSM715 from pBR322 & phage T7 & phage fd
RA   Maneewannakul S., Maneewannakul K., Ippen-Ihler K.;
RT   "The pKSM710 vector cassette provides tightly regulated lac and
RT   T7lac promoters and strategies for manipulating N-terminal
RT   protein sequences";
RL   Plasmid 31:300-307(1994).
RN   [2]
RP   1-5041
RC   pKSM715
RA   Maneewannakul S.;
RT   ;
RL   Submitted (06-JAN-1994) by:
RL   Maneewannakul S., Harvard University,
RL   CDB, 16 Divinity Avenue, Cambridge MA 02138, USA.
CC   NCBI gi: 450844
CC   NM (pKSM715)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (phagemid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pBR322)(T7)(fd)
CC   BR (pKSM710)(pKSM711)(pKSM713)
CC   OF ()
CC   OR ()
FH   Key             Location/Qualifiers
FT   misc_feature    0..0
FT                   /note="1. pBR322, ori
FT                   2. lambda, pL
FT                   3. T7, promoter
FT                   4. E. coli EcoRI-AluI 99bp, lacUV5 promoter-oper
FT                   \ aattctcactcattaggcaccccaggctttacactttatgcttccggctc
FT                   \ gtataatgtgtggaattgtgagcggataacaatttcacacaggaaacag
FT                   5. T7, terminator
FT                   6. E. coli, rrnB T1 T2 temrinators
FT                   7. Tn9 TaqI-TaqI 773bp 215..988, cat gene/#V00622
FT                   -> pKSM715 5041bp"
FT   promoter        20..36
FT                   /note="PRO bacteriophage T7 promoter"
FT   promoter        197..226
FT                   /note="PRO E. coli lacUV5 promoter"
FT   terminator      609..650
FT                   /note="TER bacteriophage T7 terminator; T-phi"
FT   terminator      707..750
FT                   /note="TER E. coli rrnBT1 terminator"
FT   terminator      881..910
FT                   /note="TER E. coli rrnBT2 terminator"
FT   terminator      1006..1052
FT                   /note="TER bacteriophage fd terminator"
FT   terminator      1116..1162
FT                   /note="TER bacteriophage fd terminator"
FT   rep_origin      1295..1750
FT                   /note="ORI bacteriophage f1"
FT   rep_origin      complement(1903..2497)
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   terminator      complement(2595..2622)
FT                   /note="TER E. coli trpA gene"
FT   CDS             335..607
FT                   /note="GEN E. coli beta-galactosidase gene (lacZ)
FT                   alpha peptide (lacZM15); NCBI gi: 450845"
FT   CDS             complement(2643..3437)
FT                   /note="ANT E. coli kanamycin resistance gene (kan)
FT                   from Tn5; aminoglycoside phosphotransferase;
FT                   NCBI gi: 450846"
FT   CDS             complement(3863..4945)
FT                   /note="REP E. coli lacI repressor gene;
FT                   GTG start codon; NCBI gi: 450847"
SQ   Sequence 5041 BP; 1158 A; 1394 C; 1287 G; 1202 T; 0 other;
     gatctcgatc ccgcgaaatt aatacgactc actatagggg aattgtgagc ggataacaat
     tcccctctag cgcgtattca ggctgaccct gcgcgctgcg cagggcttta ttgattccat
     ttttacactg atgaatgttc cgttgcgctg cccggattac aggggaatta attctcactc
     attaggcacc ccaggcttta cactttatgc ttccggctcg tataatgtgt ggaattgtga
     gcggataaca atttcacaca ggaaacagaa ttaattctta cacttagtta aattgctaac
     tttatagatt acaaaactta ggagggtttt taccatgggg gatcccaagc ttcttctaga
     ggtaccgcat gcgatatcga gctctcccgg gaattcactg gccgtcgttt tacaacgtcg
     tgactgggaa aaccctggcg ttacccaact taatcgcctt gcagcacatc cccctttcgc
     cagctggcgt aatagcgaag aggcccgcac cgatcgccct tcccaacagt tgcgcagcct
     gatccggctg ctaacaaagc ccgaaaggaa gctgagttgg ctgctgccac cgctgagcaa
     taactagcat aaccccttgg ggcctctaaa cgggtcttga ggggtttttt gctgaaagga
     ggaactatat ccggatatgc gagagtaggg aactgccagg catcaaataa aacgaaaggc
     tcagtcgaaa gactgggcct ttcgttttat ctgttgtttg tcggtgaacg ctctcctgag
     taggacaaat ccgccgggag cggatttgaa cgttgcgaag caacggcccg gagggtggcg
     ggcaggacgc ccgccataaa ctgccaggca tcaaattaag cagaaggcca tcctgacgga
     tggccttttt gcgtttctac aaactctttt gtttattttt ctaaatacat tcaaatatgt
     atccgctcat gctagaggtc gaaattcacc tcgaaagcaa gctgataaac cgatacaatt
     aaaggctcct tttggagcct ttttttttgg agattttcaa cgtgaaaaaa ttattattcg
     caattccaag ctaattcacc tcgaaagcaa gctgataaac cgatacaatt aaaggctcct
     tttggagcct ttttttttgg agattttcaa cgtgaaaaaa ttattattcg caattccaag
     ctctgcctcg cgcgtttcgg tgatgacggt gaaaacctct gacacatgca gctcccggag
     acggtcacag cttgtctgta agcggatgca gatcacgcgc cctgtagcgg cgcattaagc
     gcggcgggtg tggtggttac gcgcagcgtg accgctacac ttgccagcgc cctagcgccc
     gctcctttcg ctttcttccc ttcctttctc gccacgttcg ccagctttcc ccgtcaagct
     ctaaatcggg ggctcccttt agggttccga tttagtgctt tacggcacct cgaccccaaa
     aaacttgatt agggtgatgg ttcacgtagt gggccatcgc cctgatagac ggtttttcgc
     cctttgacgt tggagtccac gttctttaat agtggactct tgttccaaac tggaacaaca
     ctcaacccta tctcggtcta ttcttttgat ttataaggga ttttgccgat ttcggcctat
     tggttaaaaa atgagctgat ttaacaaaaa tttaacgcga attttaacaa aatattaacg
     tttacaattt gatctgcgct cggtcgttcg gctgcggcga gcggtatcag ctcactcaaa
     ggcggtaata cggttatcca cagaatcagg ggataacgca ggaaagaaca tgtgagcaaa
     aggccagcaa aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt tccataggct
     ccgcccccct gacgagcatc acaaaaatcg acgctcaagt cagaggtggc gaaacccgac
     aggactataa agataccagg cgtttccccc tggaagctcc ctcgtgcgct ctcctgttcc
     gaccctgccg cttaccggat acctctccgc ctttctccct tcgggaagcg tggcgctttc
     tcaatgctca cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca agctgggctg
     tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta tccggtaact atcgtcttga
     gtccaacccg gtaagacacg acttatcgcc actggcagca gccactggta acaggattag
     cagagcgagg tatgtaggcg gtgctacaga gttcttgaag tggtggccta actacggcta
     cactagaagg acagtatttg gtatctgcgc tctgctgaag ccagttacct tcggaaaaag
     agttggtagc tcttgatccg gcaaacaaac caccgctggt agcggtggtt tttttgtttg
     caagcagcag attacgcgca gaaaaaaagg atctcaagaa gatcctttga tcttttctac
     ggggtctgac gctgactgga acgaaaactc acgttaaggg attttggtca tgtcgacctg
     caggcatgca agctaaaaaa aagcccgctc attaggcggg ctagcgaacc ccagagtccc
     gctcagaaga actcgtcaag aaggcgatag aaggcgatgc gctgcgaatc gggagcggcg
     ataccgtaaa gcacgaggaa gcggtcagcc cattcgccgc caagctcttc agcaatatca
     cgggtagcca acgctatgtc ctgatagcgg tccgccacac ccagccggcc acagtcgatg
     aatccagaaa agcggccatt ttccaccatg atattcggca agcaggcatc gccatgggtc
     acgacgagat cctcgccgtc gggcatgcgc gccttgagcc tggcgaacag ttcggctggc
     gcgagcccct gatgctcttc gtccagatca tcctgatcga caagaccggc ttccatccga
     gtacgtgctc gctcgatgcg atgtttcgct tggtggtcga atgggcaggt agccggatca
     agcgtatgca gccgccgcat tgcatcagcc atgatggata ctttctcggc aggagcaagg
     tgagatgaca ggagatcctg ccccggcact tcgcccaata gcagccagtc ccttcccgct
     tcagtgacaa cgtcgagcac agctgcgcaa ggaacgcccg tcgtggccag ccacgatagc
     cgcgctgcct cgtcctgcag ttcattcagg gcaccggaca ggtcggtctt gacaaaaaga
     accgggcgcc cctgcgctga cagccggaac acggcggcat cagagcagcc gattgtctgt
     tgtgcccagt catagccgaa tagcctctcc acccaagcgg ccggagaacc tgcgtgcaat
     ccatcttgtt caatcatgcg aaacgatcct catcctgtct cttgatcaga tcttgatccc
     ctgcgccatc agatccttgg cggcaagaaa gccatccagt ttactttgca gggcttccca
     accttaccag agggcgcccc agctggcaat tccggttcgc ttgctgtcca taaaaccgcc
     cagtctagct atcgccatgt aagcccactg caagctacct gctttctctt tgcgcttcgc
     ttttcccttg tccagatagc ccagtagctg acattcatcc ggggtcagca ccgtttctgc
     ggactggctt tctacgtgtt ccgcttcctt tagcagccct tgcgccctga gtgcttgcgg
     cagcgtgaag ctggtcggaa gcataaagtg taaagcctgg ggtgcctaat gagtgagcta
     actcacatta attgcgttgc gctcactgcc cgctttccag tcgggaaacc tgtcgtgcca
     gctgcattaa tgaatcggcc aacgcgcggg gagaggcggt ttgcgtattg ggcgccaggg
     tggtttttct tttcaccagt gagacgggca acagctgatt gcccttcacc gcctggccct
     gagagagttg cagcaagcgg tccacgctgg tttgccccag caggcgaaaa tcctgtttga
     tggtggttga cggcgggata taacatgagc tgtcttcggt atcgtcgtat cccactaccg
     agatatccgc accaacgcgc agcccggact cggtaatggc gcgcattgcg cccagcgcca
     tctgatcgtt ggcaaccagc atcgcagtgg gaacgatgcc ctcattcagc atttgcatgg
     tttgttgaaa accggacatg gcactccagt cgccttcccg ttccgctatc ggctgaattt
     gattgcgagt gagatattta tgccagccag ccagacgcag acgcgccgag acagaactta
     atgggcccgc taacagcgcg atttgctggt gacccaatgc gaccagatgc tccacgccca
     gtcgcgtacc gtcttcatgg gagaaaataa tactgttgat gggtgtctgg tcagagacat
     caagaaataa cgccggaaca ttagtgcagg cagcttccac agcaatggca tcctggtcat
     ccagcggata gttaatgatc agcccactga cgcgttgcgc gagaagattg tgcaccgccg
     ctttacaggc ttcgacgccg cttcgttcta ccatcgacac caccacgctg gcacccagtt
     gatcggcgcg agatttaatc gccgcgacaa tttgcgacgg cgcgtgcagg gccagactgg
     aggtggcaac gccaatcagc aacgactgtt tgcccgccag ttgttgtgcc acgcggttgg
     gaatgtaatt cagctccgcc atcgccgctt ccactttttc ccgcgttttc gcagaaacgt
     ggctggcctg gttcaccacg cgggaaacgg tctgataaga gacaccggca tactctgcga
     catcgtataa cgttactggt ttcacattca ccaccctgaa ttgactctct tccgggcgct
     atcatgccat accgcgaaag gttttgcgcc attctatggt gtcgggtacc gagctcgaat