back Return to this vector's summary.
ID   PKT2       preliminary; circular DNA; SYN; 2733 BP.
XX
AC   IG5132;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pKT2 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pKT2 from pUC19
RC   pKT3 from pUC19
RC   lambda KT3 from EMBL4
RC   cosKT2 from cosKT1
RC   cosKT3 from cosKT1
RA   Tartof K.D.;
RT   "Cloning vectors and techniques for exonuclease-hybridization
RT   restriction mapping";
RL   Meth. Enzymol. 216:574-584(1992).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   MCS. oligonucleotide linker.
CC   NM (pKT2)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pUC19)(lambda KT from EMBL4)(cosKT1)
CC   BR (pKT3)(cosKT2)(cosKT3)
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pUC19 2635bp 448..2686..397, MCS
FT                   blunt end:blunt end
FT                   2. oligo MluI-NotI-T7 prom-HindIII-BamHI-EcoRI-
FT                   \ Sp6 prom-NotI-SacII 102bp
FT                   \ agctacgcgttgcggccgctaattaatacgactcactatagggagaagct
FT                   \ tacggatccgaattcctattctatagtgtcacctaaatcgtgcggccgcg
FT                   \ gt
FT                   -> pKT2 2737bp"
FT   -               1..396
FT                   /note="pUC19 1..396 396bp
FT                   EcoRI = G^AATTC
FT                   \         agctac..."
FT   -               397..498
FT                   /note="102bp
FT                   \ agctacgcgttgcggccgctaattaatacgactcactatagggagaagct
FT                   \ tacggatccgaattcctattctatagtgtcacctaaatcgtgcggccgcg
FT                   \ gt
FT                   \      ...cgcggt
FT                   HindIII = A^AGCT T"
FT   -               499..2733
FT                   /note="pUC19 452..2686 2235bp"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 2733 BP; 679 A; 685 C; 695 G; 674 T; 0 other;
     tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca
     cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg
     ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc
     accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc
     attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat
     tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt
     tttcccagtc acgacgttgt aaaacgacgg ccagtgagct acgcgttgcg gccgctaatt
     aatacgactc actataggga gaagcttacg gatccgaatt cctattctat agtgtcacct
     aaatcgtgcg gccgcggttg gcgtaatcat ggtcatagct gtttcctgtg tgaaattgtt
     atccgctcac aattccacac aacatacgag ccggaagcat aaagtgtaaa gcctggggtg
     cctaatgagt gagctaactc acattaattg cgttgcgctc actgcccgct ttccagtcgg
     gaaacctgtc gtgccagctg cattaatgaa tcggccaacg cgcggggaga ggcggtttgc
     gtattgggcg ctcttccgct tcctcgctca ctgactcgct gcgctcggtc gttcggctgc
     ggcgagcggt atcagctcac tcaaaggcgg taatacggtt atccacagaa tcaggggata
     acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg
     cgttgctggc gtttttccat aggctccgcc cccctgacga gcatcacaaa aatcgacgct
     caagtcagag gtggcgaaac ccgacaggac tataaagata ccaggcgttt ccccctggaa
     gctccctcgt gcgctctcct gttccgaccc tgccgcttac cggatacctg tccgcctttc
     tcccttcggg aagcgtggcg ctttctcaat gctcacgctg taggtatctc agttcggtgt
     aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg
     ccttatccgg taactatcgt cttgagtcca acccggtaag acacgactta tcgccactgg
     cagcagccac tggtaacagg attagcagag cgaggtatgt aggcggtgct acagagttct
     tgaagtggtg gcctaactac ggctacacta gaaggacagt atttggtatc tgcgctctgc
     tgaagccagt taccttcgga aaaagagttg gtagctcttg atccggcaaa caaaccaccg
     ctggtagcgg tggttttttt gtttgcaagc agcagattac gcgcagaaaa aaaggatctc
     aagaagatcc tttgatcttt tctacggggt ctgacgctca gtggaacgaa aactcacgtt
     aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac ctagatcctt ttaaattaaa
     aatgaagttt taaatcaatc taaagtatat atgagtaaac ttggtctgac agttaccaat
     gcttaatcag tgaggcacct atctcagcga tctgtctatt tcgttcatcc atagttgcct
     gactccccgt cgtgtagata actacgatac gggagggctt accatctggc cccagtgctg
     caatgatacc gcgagaccca cgctcaccgg ctccagattt atcagcaata aaccagccag
     ccggaagggc cgagcgcaga agtggtcctg caactttatc cgcctccatc cagtctatta
     attgttgccg ggaagctaga gtaagtagtt cgccagttaa tagtttgcgc aacgttgttg
     ccattgctac aggcatcgtg gtgtcacgct cgtcgtttgg tatggcttca ttcagctccg
     gttcccaacg atcaaggcga gttacatgat cccccatgtt gtgcaaaaaa gcggttagct
     ccttcggtcc tccgatcgtt gtcagaagta agttggccgc agtgttatca ctcatggtta
     tggcagcact gcataattct cttactgtca tgccatccgt aagatgcttt tctgtgactg
     gtgagtactc aaccaagtca ttctgagaat agtgtatgcg gcgaccgagt tgctcttgcc
     cggcgtcaat acgggataat accgcgccac atagcagaac tttaaaagtg ctcatcattg
     gaaaacgttc ttcggggcga aaactctcaa ggatcttacc gctgttgaga tccagttcga
     tgtaacccac tcgtgcaccc aactgatctt cagcatcttt tactttcacc agcgtttctg
     ggtgagcaaa aacaggaagg caaaatgccg caaaaaaggg aataagggcg acacggaaat
     gttgaatact catactcttc ctttttcaat attattgaag catttatcag ggttattgtc
     tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg gttccgcgca
     catttccccg aaaagtgcca cctgacgtct aagaaaccat tattatcatg acattaacct
     ataaaaatag gcgtatcacg aggccctttc gtc
//