back Return to this vector's summary.
ID   PL5281     preliminary; circular DNA; SYN; 4121 BP.
XX
AC   K02997; K02998;
XX
DT   20-MAR-1986 (Rel. 1, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pL5281 - complete, syn 5' & 3' mRNA splice.
XX
KW   cloning vector; splice junction.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-153, 5'
RP   1-157, 3'
RC   pL5281 from pGL101B & pBR322
RC   from pL5281 & oligo
RA   Tatei K., Takemura K., Mayeda A., Fujiwara Y., Tanaka H.,
RA   Ishihama A., Ohshima Y.;
RT   "U1 RNA-protein complex preferentially binds to both 5' and 3'
RT   splice junction sequences in RNA or single-stranded DNA";
RL   Proc. Natl. Acad. Sci. U.S.A. 81:6281-6285(1984).
XX
RN   [2]
RC   pGL101B from pBR322 & lacUV5 promoter & linker
RA   Taniguchi T.;
RT   ;
RL   Unpublished (1984).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   Artificial mRNA splice junctions were produced.  It was found that
CC   U1 snRNA binds to the 3' splice junction sequence as well as to the
CC   5' splice junction and is very specific in its recognition of these
CC   sequences.
CC   NCBI gi: 209053 & 209054
CC   NM (pL5281)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pBR322)(lambda)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 remove EcoRI-PvuII 2068bp
FT                   \ 4360..4361..2067, 2293bp
FT                   2. E. coli EcoRI-AluI 99bp, lacUV5 promoter-oper
FT                   \ aattctcactcattaggcaccccaggctttacactttatgcttccggctc
FT                   \ gtataatgtgtggaattgtgagcggataacaatttcacacaggaaacag
FT                   EcoRI-BamHI-EcoRI linker 12bp aattcggatccg:
FT                   -> pGL101B 2392bp
FT                   1. pGL101B BamHI-PvuII 105bp, linker to 3' lac
FT                   :HindIII linker 6bp aagctt
FT                   BamHI-HindIII 106bp, lacUV5 promoter
FT                   2. pBR322 remove HindIII-BamHI 346bp 30..376, 4015bp
FT                   bacterial alkaline phosphatase
FT                   -> pL5281 4000bp"
FT   -               1..4015
FT                   /note="pBR322 376..4361..29 4015bp
FT                   HindIII = A^AGCTT"
FT   -               4016..4121
FT                   /note="106bp [HindIII-PvuII-...-AluI-EcoRI-BamHI]
FT                   \ agctt
FT                   \ ctcactcattaggcaccccaggctttacactttatgcttccggctcgtat
FT                   \ aatgtgtggaattgtgagcggataacaatttcacacaggaaacag
FT                   \ aattcg
FT                   BamHI = G^GATCC"
FT   misc_recomb     14..15
FT                   /note="EcoRI linker end/E. coli lacUV promoter
FT                   start; 5'"
FT   misc_recomb     109..110
FT                   /note="E. coli lacUV promoter end/HindIII linker
FT                   start; 5'"
FT   misc_recomb     117..118
FT                   /note="HindIII linker end/synthetic mRNA splice
FT                   junction OS-11 start; 5'"
FT   misc_recomb     126..127
FT                   /note="synthetic mRNA splice junction OS-11 end/pBR322
FT                   start; 5'"
FT   misc_recomb     14..15
FT                   /note="EcoRI linker end/E. coli lacUV promoter
FT                   start; 3'"
FT   misc_recomb     111..112
FT                   /note="E. coli lacUV promoter end/HindIII linker
FT                   start; 3'"
FT   misc_recomb     116..117
FT                   /note="HindIII linker end/synthetic mRNA splice
FT                   junction OS-14 start; 3'"
FT   misc_recomb     132..133
FT                   /note="synthetic mRNA splice junction OS-14 end/pBR322
FT                   start; 3'"
XX
SQ   Sequence 4121 BP; 947 A; 1129 C; 1070 G; 975 T; 0 other;
     gatcctctac gccggacgca tcgtggccgg catcaccggc gccacaggtg cggttgctgg
     cgcctatatc gccgacatca ccgatgggga agatcgggct cgccacttcg ggctcatgag
     cgcttgtttc ggcgtgggta tggtggcagg ccccgtggcc gggggactgt tgggcgccat
     ctccttgcat gcaccattcc ttgcggcggc ggtgctcaac ggcctcaacc tactactggg
     ctgcttccta atgcaggagt cgcataaggg agagcgtcga ccgatgccct tgagagcctt
     caacccagtc agctccttcc ggtgggcgcg gggcatgact atcgtcgccg cacttatgac
     tgtcttcttt atcatgcaac tcgtaggaca ggtgccggca gcgctctggg tcattttcgg
     cgaggaccgc tttcgctgga gcgcgacgat gatcggcctg tcgcttgcgg tattcggaat
     cttgcacgcc ctcgctcaag ccttcgtcac tggtcccgcc accaaacgtt tcggcgagaa
     gcaggccatt atcgccggca tggcggccga cgcgctgggc tacgtcttgc tggcgttcgc
     gacgcgaggc tggatggcct tccccattat gattcttctc gcttccggcg gcatcgggat
     gcccgcgttg caggccatgc tgtccaggca ggtagatgac gaccatcagg gacagcttca
     aggatcgctc gcggctctta ccagcctaac ttcgatcact ggaccgctga tcgtcacggc
     gatttatgcc gcctcggcga gcacatggaa cgggttggca tggattgtag gcgccgccct
     ataccttgtc tgcctccccg cgttgcgtcg cggtgcatgg agccgggcca cctcgacctg
     aatggaagcc ggcggcacct cgctaacgga ttcaccactc caagaattgg agccaatcaa
     ttcttgcgga gaactgtgaa tgcgcaaacc aacccttggc agaacatatc catcgcgtcc
     gccatctcca gcagccgcac gcggcgcatc tcgggcagcg ttgggtcctg gccacgggtg
     cgcatgatcg tgctcctgtc gttgaggacc cggctaggct ggcggggttg ccttactggt
     tagcagaatg aatcaccgat acgcgagcga acgtgaagcg actgctgctg caaaacgtct
     gcgacctgag caacaacatg aatggtcttc ggtttccgtg tttcgtaaag tctggaaacg
     cggaagtcag cgccctgcac cattatgttc cggatctgca tcgcaggatg ctgctggcta
     ccctgtggaa cacctacatc tgtattaacg aagcgctggc attgaccctg agtgattttt
     ctctggtccc gccgcatcca taccgccagt tgtttaccct cacaacgttc cagtaaccgg
     gcatgttcat catcagtaac ccgtatcgtg agcatcctct ctcgtttcat cggtatcatt
     acccccatga acagaaatcc cccttacacg gaggcatcag tgaccaaaca ggaaaaaacc
     gcccttaaca tggcccgctt tatcagaagc cagacattaa cgcttctgga gaaactcaac
     gagctggacg cggatgaaca ggcagacatc tgtgaatcgc ttcacgacca cgctgatgag
     ctttaccgca gctgcctcgc gcgtttcggt gatgacggtg aaaacctctg acacatgcag
     ctcccggaga cggtcacagc ttgtctgtaa gcggatgccg ggagcagaca agcccgtcag
     ggcgcgtcag cgggtgttgg cgggtgtcgg ggcgcagcca tgacccagtc acgtagcgat
     agcggagtgt atactggctt aactatgcgg catcagagca gattgtactg agagtgcacc
     atatgcggtg tgaaataccg cacagatgcg taaggagaaa ataccgcatc aggcgctctt
     ccgcttcctc gctcactgac tcgctgcgct cggtcgttcg gctgcggcga gcggtatcag
     ctcactcaaa ggcggtaata cggttatcca cagaatcagg ggataacgca ggaaagaaca
     tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt
     tccataggct ccgcccccct gacgagcatc acaaaaatcg acgctcaagt cagaggtggc
     gaaacccgac aggactataa agataccagg cgtttccccc tggaagctcc ctcgtgcgct
     ctcctgttcc gaccctgccg cttaccggat acctgtccgc ctttctccct tcgggaagcg
     tggcgctttc tcatagctca cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca
     agctgggctg tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta tccggtaact
     atcgtcttga gtccaacccg gtaagacacg acttatcgcc actggcagca gccactggta
     acaggattag cagagcgagg tatgtaggcg gtgctacaga gttcttgaag tggtggccta
     actacggcta cactagaagg acagtatttg gtatctgcgc tctgctgaag ccagttacct
     tcggaaaaag agttggtagc tcttgatccg gcaaacaaac caccgctggt agcggtggtt
     tttttgtttg caagcagcag attacgcgca gaaaaaaagg atctcaagaa gatcctttga
     tcttttctac ggggtctgac gctcagtgga acgaaaactc acgttaaggg attttggtca
     tgagattatc aaaaaggatc ttcacctaga tccttttaaa ttaaaaatga agttttaaat
     caatctaaag tatatatgag taaacttggt ctgacagtta ccaatgctta atcagtgagg
     cacctatctc agcgatctgt ctatttcgtt catccatagt tgcctgactc cccgtcgtgt
     agataactac gatacgggag ggcttaccat ctggccccag tgctgcaatg ataccgcgag
     acccacgctc accggctcca gatttatcag caataaacca gccagccgga agggccgagc
     gcagaagtgg tcctgcaact ttatccgcct ccatccagtc tattaattgt tgccgggaag
     ctagagtaag tagttcgcca gttaatagtt tgcgcaacgt tgttgccatt gctgcaggca
     tcgtggtgtc acgctcgtcg tttggtatgg cttcattcag ctccggttcc caacgatcaa
     ggcgagttac atgatccccc atgttgtgca aaaaagcggt tagctccttc ggtcctccga
     tcgttgtcag aagtaagttg gccgcagtgt tatcactcat ggttatggca gcactgcata
     attctcttac tgtcatgcca tccgtaagat gcttttctgt gactggtgag tactcaacca
     agtcattctg agaatagtgt atgcggcgac cgagttgctc ttgcccggcg tcaacacggg
     ataataccgc gccacatagc agaactttaa aagtgctcat cattggaaaa cgttcttcgg
     ggcgaaaact ctcaaggatc ttaccgctgt tgagatccag ttcgatgtaa cccactcgtg
     cacccaactg atcttcagca tcttttactt tcaccagcgt ttctgggtga gcaaaaacag
     gaaggcaaaa tgccgcaaaa aagggaataa gggcgacacg gaaatgttga atactcatac
     tcttcctttt tcaatattat tgaagcattt atcagggtta ttgtctcatg agcggataca
     tatttgaatg tatttagaaa aataaacaaa taggggttcc gcgcacattt ccccgaaaag
     tgccacctga cgtctaagaa accattatta tcatgacatt aacctataaa aataggcgta
     tcacgaggcc ctttcgtctt caagaattct catgtttgac agcttatcat cgataagctt
     ctcactcatt aggcacccca ggctttacac tttatgcttc cggctcgtat aatgtgtgga
     attgtgagcg gataacaatt tcacacagga aacagaattc g
//