back Return to this vector's summary.
ID   PLH1       preliminary; circular DNA; SYN; 2680 BP.
XX
AC   IG5028;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli phagemid vector pLH1 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pLH1 from pUC19 & oligo
RC   M13LH1 from M13mp8 & oligo
RA   Howard L.A., Ortlepp S.A.;
RT   "Construction of cloning/sequencing vectors with an alternative
RT   polylinker";
RL   Biotechniques 7:940-942(1989).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   MCS, oligonucleotide linker.
CC   NM (pLH1)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (phagemid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pUC19)
CC   BR (M13LH1)
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pUC19 remove EcoRI-HindIII 51bp 397..448,
FT                   \ MCS/2635bp
FT                   2. oligo EcoRI-HindIII 45bp
FT                   \ aattcgcggccgccatggagatctcgaggcctatcgatccgcgga
FT                   -> pLH1 2680bp"
FT   -               1..396
FT                   /note="pUC19 1..396 396bp
FT                   EcoRI = G^AATTC"
FT   -               397..441
FT                   /note="45bp
FT                   \ aattcgcggccgccatggagatctcgaggcctatcgatccgcgga
FT                   HindIII = A^AGCTT"
FT   -               442..2680
FT                   /note="pUC19 448..2686 2239bp"
FT   misc_feature    1..51
FT                   /note="oligonucleotide EcoRI-HindIII 45 bp
FT                   replaces M13mp8 EcoRI-HindIII 54 bp"
FT   misc_binding    1..51
FT                   /note="MCS EcoRI-NotI-NcoI-BglII-XhoI-StuI-ClaI-
FT                   SacII-HindIII"
FT   CDS             0..0
FT                   /note="GEN E. coli beta-galactosidase gene (lacZ)"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 2680 BP; 664 A; 674 C; 685 G; 657 T; 0 other;
     tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca
     cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg
     ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc
     accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc
     attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat
     tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt
     tttcccagtc acgacgttgt aaaacgacgg ccagtgaatt cgcggccgcc atggagatct
     cgaggcctat cgatccgcgg aagcttggcg taatcatggt catagctgtt tcctgtgtga
     aattgttatc cgctcacaat tccacacaac atacgagccg gaagcataaa gtgtaaagcc
     tggggtgcct aatgagtgag ctaactcaca ttaattgcgt tgcgctcact gcccgctttc
     cagtcgggaa acctgtcgtg ccagctgcat taatgaatcg gccaacgcgc ggggagaggc
     ggtttgcgta ttgggcgctc ttccgcttcc tcgctcactg actcgctgcg ctcggtcgtt
     cggctgcggc gagcggtatc agctcactca aaggcggtaa tacggttatc cacagaatca
     ggggataacg caggaaagaa catgtgagca aaaggccagc aaaaggccag gaaccgtaaa
     aaggccgcgt tgctggcgtt tttccatagg ctccgccccc ctgacgagca tcacaaaaat
     cgacgctcaa gtcagaggtg gcgaaacccg acaggactat aaagatacca ggcgtttccc
     cctggaagct ccctcgtgcg ctctcctgtt ccgaccctgc cgcttaccgg atacctgtcc
     gcctttctcc cttcgggaag cgtggcgctt tctcaatgct cacgctgtag gtatctcagt
     tcggtgtagg tcgttcgctc caagctgggc tgtgtgcacg aaccccccgt tcagcccgac
     cgctgcgcct tatccggtaa ctatcgtctt gagtccaacc cggtaagaca cgacttatcg
     ccactggcag cagccactgg taacaggatt agcagagcga ggtatgtagg cggtgctaca
     gagttcttga agtggtggcc taactacggc tacactagaa ggacagtatt tggtatctgc
     gctctgctga agccagttac cttcggaaaa agagttggta gctcttgatc cggcaaacaa
     accaccgctg gtagcggtgg tttttttgtt tgcaagcagc agattacgcg cagaaaaaaa
     ggatctcaag aagatccttt gatcttttct acggggtctg acgctcagtg gaacgaaaac
     tcacgttaag ggattttggt catgagatta tcaaaaagga tcttcaccta gatcctttta
     aattaaaaat gaagttttaa atcaatctaa agtatatatg agtaaacttg gtctgacagt
     taccaatgct taatcagtga ggcacctatc tcagcgatct gtctatttcg ttcatccata
     gttgcctgac tccccgtcgt gtagataact acgatacggg agggcttacc atctggcccc
     agtgctgcaa tgataccgcg agacccacgc tcaccggctc cagatttatc agcaataaac
     cagccagccg gaagggccga gcgcagaagt ggtcctgcaa ctttatccgc ctccatccag
     tctattaatt gttgccggga agctagagta agtagttcgc cagttaatag tttgcgcaac
     gttgttgcca ttgctacagg catcgtggtg tcacgctcgt cgtttggtat ggcttcattc
     agctccggtt cccaacgatc aaggcgagtt acatgatccc ccatgttgtg caaaaaagcg
     gttagctcct tcggtcctcc gatcgttgtc agaagtaagt tggccgcagt gttatcactc
     atggttatgg cagcactgca taattctctt actgtcatgc catccgtaag atgcttttct
     gtgactggtg agtactcaac caagtcattc tgagaatagt gtatgcggcg accgagttgc
     tcttgcccgg cgtcaatacg ggataatacc gcgccacata gcagaacttt aaaagtgctc
     atcattggaa aacgttcttc ggggcgaaaa ctctcaagga tcttaccgct gttgagatcc
     agttcgatgt aacccactcg tgcacccaac tgatcttcag catcttttac tttcaccagc
     gtttctgggt gagcaaaaac aggaaggcaa aatgccgcaa aaaagggaat aagggcgaca
     cggaaatgtt gaatactcat actcttcctt tttcaatatt attgaagcat ttatcagggt
     tattgtctca tgagcggata catatttgaa tgtatttaga aaaataaaca aataggggtt
     ccgcgcacat ttccccgaaa agtgccacct gacgtctaag aaaccattat tatcatgaca
     ttaacctata aaaataggcg tatcacgagg ccctttcgtc
//