back Return to this vector's summary.
ID   PLINKCAT   preliminary; circular DNA; SYN; 4540 BP.
XX
AC   ATCC37715;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Vertebrate/E.coli plasmid vector pLinkCAT - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pLinkCAT from pSV2-cat & oligo
RA   Wu Y.L., Tam S.P., Davies P.L.;
RT   "A modified CAT expression vector with convenient cloning sites";
RL   Nucleic Acids Res. 18:1919-1919(1990).
XX
RN   [2]
RC   pWB5A from pRK290 & piVX
RC   pLINK322 from pBR322 & linker
RA   Maniatis T., Fritsch E., Sambrook J.;
RT   ;
RL   Molecular Cloning Laboratory Manual 0:0-0(1982).
RL   Maniatis T., Fritsch E., Sambrook J.;
RL   Cold Spring Harbor Laboratory, Cold Spring Harbor NY.
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   This was constructed from the large AccI/HindIII pSV2CAT fragment and
CC   a polylinker with AccI and HindIII ends such that the AccI at the end
CC   was lost.
CC   This is a promoter-cloning shuttle plasmid vector with a polylinker
CC   which can facilitate both molecular cloning of a DNA fragment as well
CC   as controlled deletion of sequence from either end of the insert.
CC   Restriction digests of the clone give the following sizes (kb):
CC   HindIII--4.5; BglII--4.5; SstI--4.5; consistent with deposited DNA.
CC   (ATCC staff)
CC   Medium is 1227 LB plus ampicillin.
CC   NM (pLinkCAT)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (ATCC)
CC   HO (E.coli HB101)(vertebrate cells)(E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA ()
CC   BR (pSV2-cat)
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pSV2-cat remove HindIII-AccI 506bp
FT                   \ 5002..5003..505, 4497bp
FT                   2. oligo HindIII-KpnI-XmaI/SmaI-SalI/AccI-
FT                   \ BglII-XbaI-SstI/SacI 44bp
FT                   \ aagcttggtaccccggggtcgacagatcttctagagagctcaat
FT                   -> pLinkCAT 4441bp [unique AccI]"
FT   -               1..4497
FT                   /note="pSV2-cat 505..5001 4497bp
FT                   HindIII = A^AGCTT
FT                   \           agctt..."
FT   -               4498..4540
FT                   /note="43bp
FT                   \ agcttggtaccccggggtcgacagatcttctagagagctcaat
FT                   \ ...tcaat
FT                   AccI =  GT^MKAC"
FT   misc_binding    0..0
FT                   /note="MCS HindIII-KpnI-XmaI-SmaI-SalI-AccI-BglII-
FT                   XbaI-SstI"
FT   misc_binding    0..0
FT                   /note="SIT unique HindIII-KpnI-XmaI-SmaI-SalI-AccI-
FT                   BglII-XbaI-SstI"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   CDS             0..0
FT                   /note="ANT E. coli chloramphenicol acetyltransferase
FT                   gene (cat); chloramphenicol resistance gene (cmr/cml);
FT                   reporter gene"
XX
SQ   Sequence 4540 BP; 1278 A; 1013 C; 1008 G; 1241 T; 0 other;
     atactggctt aactatgcgg catcagagca gattgtactg agagtgcacc atatgcggtg
     tgaaataccg cacagatgcg taaggagaaa ataccgcatc aggcgctctt ccgcttcctc
     gctcactgac tcgctgcgct cggtcgttcg gctgcggcga gcggtatcag ctcactcaaa
     ggcggtaata cggttatcca cagaatcagg ggataacgca ggaaagaaca tgtgagcaaa
     aggccagcaa aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt tccataggct
     ccgcccccct gacgagcatc acaaaaatcg acgctcaagt cagaggtggc gaaacccgac
     aggactataa agataccagg cgtttccccc tggaagctcc ctcgtgcgct ctcctgttcc
     gaccctgccg cttaccggat acctgtccgc ctttctccct tcgggaagcg tggcgctttc
     tcatagctca cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca agctgggctg
     tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta tccggtaact atcgtcttga
     gtccaacccg gtaagacacg acttatcgcc actggcagca gccactggta acaggattag
     cagagcgagg tatgtaggcg gtgctacaga gttcttgaag tggtggccta actacggcta
     cactagaagg acagtatttg gtatctgcgc tctgctgaag ccagttacct tcggaaaaag
     agttggtagc tcttgatccg gcaaacaaac caccgctggt agcggtggtt tttttgtttg
     caagcagcag attacgcgca gaaaaaaagg atctcaagaa gatcctttga tcttttctac
     ggggtctgac gctcagtgga acgaaaactc acgttaaggg attttggtca tgagattatc
     aaaaaggatc ttcacctaga tccttttaaa ttaaaaatga agttttaaat caatctaaag
     tatatatgag taaacttggt ctgacagtta ccaatgctta atcagtgagg cacctatctc
     agcgatctgt ctatttcgtt catccatagt tgcctgactc cccgtcgtgt agataactac
     gatacgggag ggcttaccat ctggccccag tgctgcaatg ataccgcgag acccacgctc
     accggctcca gatttatcag caataaacca gccagccgga agggccgagc gcagaagtgg
     tcctgcaact ttatccgcct ccatccagtc tattaattgt tgccgggaag ctagagtaag
     tagttcgcca gttaatagtt tgcgcaacgt tgttgccatt gctgcaggca tcgtggtgtc
     acgctcgtcg tttggtatgg cttcattcag ctccggttcc caacgatcaa ggcgagttac
     atgatccccc atgttgtgca aaaaagcggt tagctccttc ggtcctccga tcgttgtcag
     aagtaagttg gccgcagtgt tatcactcat ggttatggca gcactgcata attctcttac
     tgtcatgcca tccgtaagat gcttttctgt gactggtgag tactcaacca agtcattctg
     agaatagtgt atgcggcgac cgagttgctc ttgcccggcg tcaacacggg ataataccgc
     gccacatagc agaactttaa aagtgctcat cattggaaaa cgttcttcgg ggcgaaaact
     ctcaaggatc ttaccgctgt tgagatccag ttcgatgtaa cccactcgtg cacccaactg
     atcttcagca tcttttactt tcaccagcgt ttctgggtga gcaaaaacag gaaggcaaaa
     tgccgcaaaa aagggaataa gggcgacacg gaaatgttga atactcatac tcttcctttt
     tcaatattat tgaagcattt atcagggtta ttgtctcatg agcggataca tatttgaatg
     tatttagaaa aataaacaaa taggggttcc gcgcacattt ccccgaaaag tgccacctga
     cgtctaagaa accattatta tcatgacatt aacctataaa aataggcgta tcacgaggcc
     ctttcgtctt caagaattcc tttgcctaat ttaaatgagg acttaacctg tggaaatatt
     ttgatgtggg aagctgttac tgttaaaact gaggttattg gggtaactgc tatgttaaac
     ttgcattcag ggacacaaaa aactcatgaa aatggtgctg gaaaacccat tcaagggtca
     aattttcatt tttttgctgt tggtggggaa cctttggagc tgcagggtgt gttagcaaac
     tacaggacca aatatcctgc tcaaactgta accccaaaaa atgctacagt tgacagtcag
     cagatgaaca ctgaccacaa ggctgttttg gataaggata atgcttatcc agtggagtgc
     tgggttcctg atccaagtaa aaatgaaaac actagatatt ttggaaccta cacaggtggg
     gaaaatgtgc ctcctgtttt gcacattact aacacagcaa ccacagtgct tcttgatgag
     cagggtgttg ggcccttgtg caaagctgac agcttgtatg tttctgctgt tgacatttgt
     gggctgttta ccaacacttc tggaacacag cagtggaagg gacttcccag atattttaaa
     attaccctta gaaagcggtc tgtgaaaaac ccctacccaa tttccttttt gttaagtgac
     ctaattaaca ggaggacaca gagggtggat gggcagccta tgattggaat gtcctctcaa
     gtagaggagg ttagggttta tgaggacaca gaggagcttc ctggggatcc agacatgata
     agatacattg atgagtttgg acaaaccaca actagaatgc agtgaaaaaa atgctttatt
     tgtgaaattt gtgatgctat tgctttattt gtaaccatta taagctgcaa taaacaagtt
     aacaacaaca attgcattca ttttatgttt caggttcagg gggaggtgtg ggaggttttt
     taaagcaagt aaaacctcta caaatgtggt atggctgatt atgatctcta gtcaaggcac
     tatacatcaa atattcctta ttaacccctt tacaaattaa aaagctaaag gtacacaatt
     tttgagcata gttattaata gcagacactc tatgcctgtg tggagtaaga aaaaacagta
     tgttatgatt ataactgtta tgcctactta taaaggttac agaatatttt tccataattt
     tcttgtatag cagtgcagct ttttcctttg tggtgtaaat agcaaagcaa gcaagagttc
     tattactaaa cacagcatga ctcaaaaaac ttagcaattc tgaaggaaag tccttggggt
     cttctacctt tctcttcttt tttggaggag tagaatgttg agagtcagca gtagcctcat
     catcactaga tggcatttct tctgagcaaa acaggttttc ctcattaaag gcattccacc
     actgctccca ttcatcagtt ccataggttg gaatctaaaa tacacaaaca attagaatca
     gtagtttaac acattataca cttaaaaatt ttatatttac cttagagctt taaatctctg
     taggtagttt gtccaattat gtcacaccac agaagtaagg ttccttcaca aagatccggc
     gaatttctgc cattcatccg cttattatca cttattcagg cgtagcacca ggcgtttaag
     ggcaccaata actgccttaa aaaaattacg ccccgccctg ccactcatcg cagtactgtt
     gtaattcatt aagcattctg ccgacatgga agccatcaca gacggcatga tgaacctgaa
     tcgccagcgg catcagcacc ttgtcgcctt gcgtataata tttgcccatg gtgaaaacgg
     gggcgaagaa gttgtccata ttggccacgt ttaaatcaaa actggtgaaa ctcacccagg
     gattggctga gacgaaaaac atattctcaa taaacccttt agggaaatag gccaggtttt
     caccgtaaca cgccacatct tgcgaatata tgtgtagaaa ctgccggaaa tcgtcgtggt
     attcactcca gagcgatgaa aacgtttcag tttgctcatg gaaaacggtg taacaagggt
     gaacactatc ccatatcacc agctcaccgt ctttcattgc catacggaat tccggatgag
     cattcatcag gcgggcaaga atgtgaataa aggccggata aaacttgtgc ttatttttct
     ttacggtctt taaaaaggcc gtaatatcca gctgaacggt ctggttatag gtacattgag
     caactgactg aaatgcctca aaatgttctt tacgatgcca ttgggatata tcaacggtgg
     tatatccagt gatttttttc tccattttag cttccttagc tcctgaaaat ctcgccaagc
     ttggtacccc ggggtcgaca gatcttctag agagctcaat
//