back Return to this vector's summary.
ID   PLSV40     preliminary; circular DNA; SYN; 9633 BP.
XX
AC   IG9909;
XX
DT   01-JUL-1995 (Rel. 11, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pLSV40 - complete, SV40 early promoter.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pSV1 from pBR322 & SV40 early genes
RC   pAS from pSV1
RC   pEMP from pSV1 & SV40 T antigen
RC   HS0, HS1, HS2, HS3, HS4, HS6 from pSV1 & pEMP
RC   pHS102 from pBR322 & SV40
RA   Benoist C., Chambon P.;
RT   "Deletions covering the putative promoter region of early mRNAs of
RT   simian virus 40 do not abolish T-antigen expression";
RL   Proc. Natl. Acad. Sci. U.S.A. 77:3865-3869(1980).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   NM (pSV40)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pBR322)(SV40)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 BamHI 4361bp 376..376
FT                   2. SV40 BamHI 5243bp 2534..2534
FT                   -> pSV40 9604bp
FT                   1. pSV40 HindIII 9604bp, SV40 5172..5172
FT                   Klenow
FT                   BclI 9608bp, SV40 2271..2271
FT                   2. linker BglII-SmaI-XbaI 26bp
FT                   \ agatctcccgggtctagataagtaat
FT                   -> pLSV40 (OL/PL) 9634bp"
FT   -               1..375
FT                   /note="pBR322 1..375 375bp
FT                   BamHI = G^GATCC"
FT   -               376..3017
FT                   /note="SV40 2534..5175 2642bp
FT                   HindIII = A^AGCT T
FT                   HindIII =      A^AGCTT"
FT   -               3018..5359
FT                   /note="SV40 5172..5243..2270 2342bp
FT                   BclI = T^GATCA
FT                   \        gatct..."
FT   -               5360..5384
FT                   /note="gatctcccgggtctagataagtaat 25bp
FT                   \ ...aagtaat
FT                   BclI =     T^GATCA"
FT   -               5385..5647
FT                   /note="SV40 2271..2533 263bp
FT                   BamHI = G^GATCC"
FT   -               5648..9633
FT                   /note="pBR322 376..4361 3986bp"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 9633 BP; 2509 A; 2316 C; 2180 G; 2628 T; 0 other;
     ttctcatgtt tgacagctta tcatcgataa gctttaatgc ggtagtttat cacagttaaa
     ttgctaacgc agtcaggcac cgtgtatgaa atctaacaat gcgctcatcg tcatcctcgg
     caccgtcacc ctggatgctg taggcatagg cttggttatg ccggtactgc cgggcctctt
     gcgggatatc gtccattccg acagcatcgc cagtcactat ggcgtgctgc tagcgctata
     tgcgttgatg caatttctat gcgcacccgt tctcggagca ctgtccgacc gctttggccg
     ccgcccagtc ctgctcgctt cgctacttgg agccactatc gactacgcga tcatggcgac
     cacacccgtc ctgtggatcc agacatgata agatacattg atgagtttgg acaaaccaca
     actagaatgc agtgaaaaaa atgctttatt tgtgaaattt gtgatgctat tgctttattt
     gtaaccatta taagctgcaa taaacaagtt aacaacaaca attgcattca ttttatgttt
     caggttcagg gggaggtgtg ggaggttttt taaagcaagt aaaacctcta caaatgtggt
     atggctgatt atgatcatga acagactgtg aggactgagg ggcctgaaat gagccttggg
     actgtgaatc aatgcctgtt tcatgccctg agtcttccat gttcttctcc ccaccatctt
     catttttatc agcattttcc tggctgtctt catcatcatc atcactgttt cttagccaat
     ctaaaactcc aattcccata gccacattaa acttcatttt ttgatacact gacaaactaa
     actctttgtc caatctctct ttccactcca caattctgct ctgaatactt tgagcaaact
     cagccacagg tctgtaccaa attaacataa gaagcaaagc aatgccactt tgaattattc
     tcttttctaa caaaaactca ctgcgttcca ggcaatgctt taaataatct ttgggcctaa
     aatctatttg ttttacaaat ctggcctgca gtgttttagg cacactgtac tcattcatgg
     tgactattcc agggggaaat atttgagttc ttttatttag gtgtttcttt tctaagttta
     ccttaacact gccatccaaa taatccctta aattgtccag gttattaatt ccctgacctg
     aaggcaaatc tctggactcc cctccagtgc cctttacatc ctcaaaaact actaaaaact
     ggtcaatagc tactcctagc tcaaagttca gcctgtccaa gggcaaatta acatttaaag
     ctttcccccc acataattca agcaaagcag ctgctaatgt agttttacca ctatcaattg
     gtcctttaaa cagccagtat ctttttttag gaatgttgta caccatgcat tttaaaaagt
     catacaccac tgaatccatt ttgggcaaca aacagtgtag ccaagcaact ccagccatcc
     attcttctat gtcagcagag cctgtagaac caaacattat atccatccta tccaaaagat
     cattaaatct gtttgttaac atttgttctc tagttaattg taggctatca acccgctttt
     tagctaaaac agtatcaaca gcctgttggc atatggtttt ttggtttttg ctgtcagcaa
     atatagcagc atttgcataa tgcttttcat ggtacttata gtggctgggc tgttcttttt
     taatacattt taaacacatt tcaaaactgt actgaaattc caagtacatc ccaagcaata
     acaacacatc atcacatttt gtttccattg catactctgt tacaagcttc caggacactt
     gtttagtttc ctctgcttct tctggattaa aatcatgctc ctttaaccca cctggcaaac
     tttcctcaat aacagaaaat ggatctctag tcaaggcact atacatcaaa tattccttat
     taaccccttt acaaattaaa aagctaaagg tacacaattt ttgagcatag ttattaatag
     cagacactct atgcctgtgt ggagtaagaa aaaacagtat gttatgatta taactgttat
     gcctacttat aaaggttaca gaatattttt ccataatttt cttgtatagc agtgcagctt
     tttcctttgt ggtgtaaata gcaaagcaag caagagttct attactaaac acagcatgac
     tcaaaaaact tagcaattct gaaggaaagt ccttggggtc ttctaccttt ctcttctttt
     ttggaggagt agaatgttga gagtcagcag tagcctcatc atcactagat ggcatttctt
     ctgagcaaaa caggttttcc tcattaaagg cattccacca ctgctcccat tcatcagttc
     cataggttgg aatctaaaat acacaaacaa ttagaatcag tagtttaaca cattatacac
     ttaaaaattt tatatttacc ttagagcttt aaatctctgt aggtagtttg tccaattatg
     tcacaccaca gaagtaaggt tccttcacaa agatcaagtc caaaccacat tctaaagcaa
     tcgaagcagt agcaatcaac ccacacaagt ggatctttcc tgtataattt tctattttca
     tgcttcatcc tcagtaagca cagcaagcat atgcagttag cagacatttt ctttgcacac
     tcaggccatt gtttgcagta cattgcatca acaccaggat ttaaggaaga agcaaatacc
     tcagttgcat cccagaagcc tccaaagtca ggttgatgag catattttac tccatcttcc
     attttcttgt acagagtatt cattttcttc attttttctt catctcctcc tttatcagga
     tgaaactcct tgcatttttt taaatatgcc tttctcatca gaggaatatt cccccaggca
     ctcctttcaa gacctagaag gtccattagc tgcaaagatt cctctctgtt taaaacttta
     tccatctttg caaagctagc tttttgcaaa agcctaggcc tccaaaaaag cctcctcact
     acttctggaa tagctcagag gccgaggcgg cctcggcctc tgcataaata aaaaaaatta
     gtcagccatg gggcggagaa tgggcggaac tgggcggagt taggggcggg atgggcggag
     ttaggggcgg gactatggtt gctgactaat tgagatgcat gctttgcata cttctgcctg
     ctggggagcc tggggacttt ccacacctgg ttgctgacta attgagatgc atgctttgca
     tacttctgcc tgctggggag cctggggact ttccacaccc taactgacac acattccaca
     gctggttctt tccgcctcag aaggtaccta accaagttcc tctttcagag gttatttcag
     gccatggtgc tgcgccggct gtcacgccag gcctccgtta aggttcgtag gtcatggact
     gaaagtaaaa aaacagctca acgccttttt gtgtttgttt tagagctttt gctgcaattt
     tgtgaagggg aagatactgt tgacgggaaa cgcaaaaaac cagaaaggtt aactgaaaaa
     ccagaaagtt aactggtaag tttagtcttt ttgtctttta tttcaggtcc atgggtgctg
     ctttaacact gttgggggac ctaattgcta ctgtgtctga agctgctgct gctactggat
     tttcagtagc tgaaattgct gctggagagg ccgctgctgc aattgaagtg caacttgcat
     ctgttgctac tgttgaaggc ctaacaacct ctgaggcaat tgctgctata ggcctcactc
     cacaggccta tgctgtgata tctggggctc ctgctgctat agctggattt gcagctttac
     tgcaaactgt gactggtgtg agcgctgttg ctcaagtggg gtatagattt tttagtgact
     gggatcacaa agtttctact gttggtttat atcaacaacc aggaatggct gtagatttgt
     ataggccaga tgattactat gatattttat ttcctggagt acaaaccttt gttcacagtg
     ttcagtatct tgaccccaga cattggggtc caacactttt taatgccatt tctcaagctt
     tttggcgtgt aatacaaaat gacattccta ggctcacctc acaggagctt gaaagaagaa
     cccaaagata tttaagggac agtttggcaa ggtttttaga ggaaactact tggacagtaa
     ttaatgctcc tgttaattgg tataactctt tacaagatta ctactctact ttgtctccca
     ttaggcctac aatggtgaga caagtagcca acagggaagg gttgcaaata tcatttgggc
     acacctatga taatattgat gaagcagaca gtattcagca agtaactgag aggtgggaag
     ctcaaagcca aagtcctaat gtgcagtcag gtgaatttat tgaaaaattt gaggctcctg
     gtggtgcaaa tcaaagaact gctcctcagt ggatgttgcc tttacttcta ggcctgtacg
     gaagtgttac ttctgctcta aaagcttatg aagatggccc caacaaaaag aaaaggaagt
     tgtccagggg cagctcccaa aaaaccaaag gaaccagtgc aagtgccaaa gctcgtcata
     aaaggaggaa tagaagttct aggagttaaa actggagtag acagcttcac tgaggtggag
     tgctttttaa atcctcaaat gggcaatcct gatgaacatc aaaaaggctt aagtaaaagc
     ttagcagctg aaaaacagtt tacagatgac tctccagaca aagaacaact gccttgctac
     agtgtggcta gaattccttt gcctaattta aatgaggact taacctgtgg aaatattttg
     atgtgggaag ctgttactgt taaaactgag gttattgggg taactgctat gttaaacttg
     cattcaggga cacaaaaaac tcatgaaaat ggtgctggaa aacccattca agggtcaaat
     tttcattttt ttgctgttgg tggggaacct ttggagctgc agggtgtgtt agcaaactac
     aggaccaaat atcctgctca aactgtaacc ccaaaaaatg ctacagttga cagtcagcag
     atgaacactg accacaaggc tgttttggat aaggataatg cttatccagt ggagtgctgg
     gttcctgatc caagtaaaaa tgaaaacact agatattttg gaacctacac aggtggggaa
     aatgtgcctc ctgttttgca cattactaac acagcaacca cagtgcttct tgatgagcag
     ggtgttgggc ccttgtgcag atctcccggg tctagataag taataagctg acagcttgta
     tgtttctgct gttgacattt gtgggctgtt taccaacact tctggaacac agcagtggaa
     gggacttccc agatatttta aaattaccct tagaaagcgg tctgtgaaaa acccctaccc
     aatttccttt ttgttaagtg acctaattaa caggaggaca cagagggtgg atgggcagcc
     tatgattgga atgtcctctc aagtagagga ggttagggtt tatgaggaca cagaggagct
     tcctggggat cctctacgcc ggacgcatcg tggccggcat caccggcgcc acaggtgcgg
     ttgctggcgc ctatatcgcc gacatcaccg atggggaaga tcgggctcgc cacttcgggc
     tcatgagcgc ttgtttcggc gtgggtatgg tggcaggccc cgtggccggg ggactgttgg
     gcgccatctc cttgcatgca ccattccttg cggcggcggt gctcaacggc ctcaacctac
     tactgggctg cttcctaatg caggagtcgc ataagggaga gcgtcgaccg atgcccttga
     gagccttcaa cccagtcagc tccttccggt gggcgcgggg catgactatc gtcgccgcac
     ttatgactgt cttctttatc atgcaactcg taggacaggt gccggcagcg ctctgggtca
     ttttcggcga ggaccgcttt cgctggagcg cgacgatgat cggcctgtcg cttgcggtat
     tcggaatctt gcacgccctc gctcaagcct tcgtcactgg tcccgccacc aaacgtttcg
     gcgagaagca ggccattatc gccggcatgg cggccgacgc gctgggctac gtcttgctgg
     cgttcgcgac gcgaggctgg atggccttcc ccattatgat tcttctcgct tccggcggca
     tcgggatgcc cgcgttgcag gccatgctgt ccaggcaggt agatgacgac catcagggac
     agcttcaagg atcgctcgcg gctcttacca gcctaacttc gatcactgga ccgctgatcg
     tcacggcgat ttatgccgcc tcggcgagca catggaacgg gttggcatgg attgtaggcg
     ccgccctata ccttgtctgc ctccccgcgt tgcgtcgcgg tgcatggagc cgggccacct
     cgacctgaat ggaagccggc ggcacctcgc taacggattc accactccaa gaattggagc
     caatcaattc ttgcggagaa ctgtgaatgc gcaaaccaac ccttggcaga acatatccat
     cgcgtccgcc atctccagca gccgcacgcg gcgcatctcg ggcagcgttg ggtcctggcc
     acgggtgcgc atgatcgtgc tcctgtcgtt gaggacccgg ctaggctggc ggggttgcct
     tactggttag cagaatgaat caccgatacg cgagcgaacg tgaagcgact gctgctgcaa
     aacgtctgcg acctgagcaa caacatgaat ggtcttcggt ttccgtgttt cgtaaagtct
     ggaaacgcgg aagtcagcgc cctgcaccat tatgttccgg atctgcatcg caggatgctg
     ctggctaccc tgtggaacac ctacatctgt attaacgaag cgctggcatt gaccctgagt
     gatttttctc tggtcccgcc gcatccatac cgccagttgt ttaccctcac aacgttccag
     taaccgggca tgttcatcat cagtaacccg tatcgtgagc atcctctctc gtttcatcgg
     tatcattacc cccatgaaca gaaatccccc ttacacggag gcatcagtga ccaaacagga
     aaaaaccgcc cttaacatgg cccgctttat cagaagccag acattaacgc ttctggagaa
     actcaacgag ctggacgcgg atgaacaggc agacatctgt gaatcgcttc acgaccacgc
     tgatgagctt taccgcagct gcctcgcgcg tttcggtgat gacggtgaaa acctctgaca
     catgcagctc ccggagacgg tcacagcttg tctgtaagcg gatgccggga gcagacaagc
     ccgtcagggc gcgtcagcgg gtgttggcgg gtgtcggggc gcagccatga cccagtcacg
     tagcgatagc ggagtgtata ctggcttaac tatgcggcat cagagcagat tgtactgaga
     gtgcaccata tgcggtgtga aataccgcac agatgcgtaa ggagaaaata ccgcatcagg
     cgctcttccg cttcctcgct cactgactcg ctgcgctcgg tcgttcggct gcggcgagcg
     gtatcagctc actcaaaggc ggtaatacgg ttatccacag aatcagggga taacgcagga
     aagaacatgt gagcaaaagg ccagcaaaag gccaggaacc gtaaaaaggc cgcgttgctg
     gcgtttttcc ataggctccg cccccctgac gagcatcaca aaaatcgacg ctcaagtcag
     aggtggcgaa acccgacagg actataaaga taccaggcgt ttccccctgg aagctccctc
     gtgcgctctc ctgttccgac cctgccgctt accggatacc tgtccgcctt tctcccttcg
     ggaagcgtgg cgctttctca tagctcacgc tgtaggtatc tcagttcggt gtaggtcgtt
     cgctccaagc tgggctgtgt gcacgaaccc cccgttcagc ccgaccgctg cgccttatcc
     ggtaactatc gtcttgagtc caacccggta agacacgact tatcgccact ggcagcagcc
     actggtaaca ggattagcag agcgaggtat gtaggcggtg ctacagagtt cttgaagtgg
     tggcctaact acggctacac tagaaggaca gtatttggta tctgcgctct gctgaagcca
     gttaccttcg gaaaaagagt tggtagctct tgatccggca aacaaaccac cgctggtagc
     ggtggttttt ttgtttgcaa gcagcagatt acgcgcagaa aaaaaggatc tcaagaagat
     cctttgatct tttctacggg gtctgacgct cagtggaacg aaaactcacg ttaagggatt
     ttggtcatga gattatcaaa aaggatcttc acctagatcc ttttaaatta aaaatgaagt
     tttaaatcaa tctaaagtat atatgagtaa acttggtctg acagttacca atgcttaatc
     agtgaggcac ctatctcagc gatctgtcta tttcgttcat ccatagttgc ctgactcccc
     gtcgtgtaga taactacgat acgggagggc ttaccatctg gccccagtgc tgcaatgata
     ccgcgagacc cacgctcacc ggctccagat ttatcagcaa taaaccagcc agccggaagg
     gccgagcgca gaagtggtcc tgcaacttta tccgcctcca tccagtctat taattgttgc
     cgggaagcta gagtaagtag ttcgccagtt aatagtttgc gcaacgttgt tgccattgct
     gcaggcatcg tggtgtcacg ctcgtcgttt ggtatggctt cattcagctc cggttcccaa
     cgatcaaggc gagttacatg atcccccatg ttgtgcaaaa aagcggttag ctccttcggt
     cctccgatcg ttgtcagaag taagttggcc gcagtgttat cactcatggt tatggcagca
     ctgcataatt ctcttactgt catgccatcc gtaagatgct tttctgtgac tggtgagtac
     tcaaccaagt cattctgaga atagtgtatg cggcgaccga gttgctcttg cccggcgtca
     acacgggata ataccgcgcc acatagcaga actttaaaag tgctcatcat tggaaaacgt
     tcttcggggc gaaaactctc aaggatctta ccgctgttga gatccagttc gatgtaaccc
     actcgtgcac ccaactgatc ttcagcatct tttactttca ccagcgtttc tgggtgagca
     aaaacaggaa ggcaaaatgc cgcaaaaaag ggaataaggg cgacacggaa atgttgaata
     ctcatactct tcctttttca atattattga agcatttatc agggttattg tctcatgagc
     ggatacatat ttgaatgtat ttagaaaaat aaacaaatag gggttccgcg cacatttccc
     cgaaaagtgc cacctgacgt ctaagaaacc attattatca tgacattaac ctataaaaat
     aggcgtatca cgaggccctt tcgtcttcaa gaa
//