back Return to this vector's summary.
ID   PM         preliminary; circular DNA; SYN; 5166 BP.
XX
AC   ATCC77383;
XX
DT   03-FEB-1994 (Rel. 8, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Vertebrate/E.coli plasmid vector pM - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pS1 from pUC19 & oligo
RC   pS1-polyA from pS1 & pMAMneo
RC   pS1-MT from pS1 & pT24
RC   pS1-MMTV from pS1 & pMAMneo
RC   pS3 from pS1
RC   pS5 from pS3
RC   pK from pUC19 & oligo
RC   pM from pK & pS1-polyA & pS1-MMTV, RSV LTR/MMTV LTR
RC   pT from pK & pS1-polyA & pS1-MT, MT gene
RC   pM-hyg from pM & pHT, hyg gene
RC   pMB-hyg from pM-hyg & pS5, lacZ-amb
RC   pMB from pMB-hyg
RC   pT-hyg from pT & pHT, hyg gene
RC   pTB-hyg from pT-hyg & pS5, lacZ-amb
RC   pTB from pTB-hyg
RA   Wang Q., Maher V.M., McCormick J.J.;
RT   "Mammalian expression vectors with modulatable promoters and two
RT   multiple cloning sites";
RL   Gene 119:155-161(1992).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   Deposited by: J. Justin McCormick
CC   Restriction digests of the clone give the following sizes (kb):
CC   PvuI--3.4, 1.8; EcoRI--2.6, 2.6; BglII--5.2; ClaI--4.1, 1.1. (ATCC
CC   staff)
CC   Expression vector containing two multiple cloning sites: the first
CC   being within the lacZ' gene, and the second being flanked by an RSV
CC   enhancer-MMTV LTR promoter at one end and splicing and
CC   polyadenylation signals at the other. [1]
CC   The first site was designed for insertion of a marker selectable in
CC   mammalian cells, and the second for the sequence to be expressed.  The
CC   first site permits detection of inserts by alpha complementation. [1]
CC   The plasmid contains the following restriction sites (bp from 0):
CC   NotI--0; EcoRI--9, 2640; ClaI--425, 1560; DrdI--1398, 3152, 5021;
CC   BglII--1605; SphI--2476; NsiI--2478; PvuI--2522, 4310; HindIII--2691;
CC   BsaI--4010. (personal communication)
CC   The order of the major features in this plasmid is: NotI/EcoRI -
CC   5' RSV enhancer - MMTV LTR 3' - ClaI/MCSII'/BglII - splicing -
CC   polyadenylation - NsiI - 3' lacZ' - EcoRI/MCSI/HindIII - 5' lacZ' -
CC   pMB1 ori - ampR. [1]
CC   Medium is 1227 LB plus ampicillin.
CC   NM (pM)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (ATCC)
CC   HO (E.coli)(E.coli HB101)(E.coli JM105)(E.coli JM109)
CC   HO (vertebrate cells)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pMAMneo)(pS1)(pK)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pS1 HpaI 2770bp 486..486, in oligo at 72..72
FT                   2. pMAMneo XhoI-BamHI 853bp 1570..2423,
FT                   \ SV40 early splicing/polyA
FT                   fill in:fill in
FT                   -> pS1-polyA 3620bp
FT                   1. pS1 NruI 3620bp 428..428, in oligo at 14..14
FT                   2. pMAMneo EcoRI-NheI 1543bp 2..1545,
FT                   \ RSV enhancer/MTTV LTR
FT                   fill in:fill in
FT                   -> pS1-MMTV 5160bp
FT                   1. pK remove NotI-NsiI 75bp 240..315, oligo/2687bp
FT                   2. pS1-MMTV NotI-XhoI 1550bp, RSV enhancer/MTTV LTR
FT                   \ S1 oligo NotI 5..5
FT                   \ pS1 oligo XhoI 41..41
FT                   3. pS1-polyA XhoI-NsiI 934bp, polyA
FT                   \ pS1 oligo XhoI 41..41
FT                   \ pS1 oligo NsiI 80..80
FT                   -> pM 5169bp"
FT   -               1..239
FT                   /note="pK 1..239 239bp
FT                   NotI = GC^GGCCGC"
FT   -               240..248
FT                   /note="ggccgctcg 9bp
FT                   \ ggccgctcg
FT                   NruI =  TCG^CGA
FT                   EcoRI =   G^AATTC"
FT   -               249..1795
FT                   /note="pMAMneo 2..1548 1547bp
FT                   NheI = G^CTAG C
FT                   NruI =    TCG^CGA"
FT   -               1796..1822
FT                   /note="cgaatcgatagctagcgcgcactagtc 27bp
FT                   XhoI = C^TCGAG"
FT   -               1823..1853
FT                   /note="tcgaggcgccggcacgcgtacgagatctgtt 31bp
FT                   HpaI = GTT^AAC
FT                   XhoI =   C^TCGAG"
FT   -               1854..2710
FT                   /note="pMAMneo 1570..2426 857bp
FT                   BamHI = G^GATC C
FT                   HpaI =     GTT^AAC"
FT   -               2711..2718
FT                   /note="aacatgca 8bp
FT                   NsiI = ATGCA^T = AvaIII = ATGCAT"
FT   -               2719..5166
FT                   /note="pK 315..2762 2448bp
FT                   NotI = GC^GGCCGC"
FT   misc_binding    0..0
FT                   /note="MCS ClaI-NheI-BssHII-SpeI-XhoI-NarI-NaeI-
FT                   MluI-SplI-BglII; pUC19 MCSI/MCSII"
FT   misc_binding    0..0
FT                   /note="SIT unique KpnI-SmaI-BamHI-XbaI-SalI-AccI-
FT                   PstI-BssHII-SpeI-XhoI-NaeI-MluI-SplI-BglII"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   promoter        0..0
FT                   /note="PRO E. coli lac"
FT   promoter        0..0
FT                   /note="PRO MMTV LTR"
FT   CDS             0..0
FT                   /note="GEN E. coli beta-galactosidase gene (lacZ');
FT                   reporter gene"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
XX
SQ   Sequence 5166 BP; 1400 A; 1179 C; 1195 G; 1392 T; 0 other;
     tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca
     cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg
     ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc
     accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcg
     gccgctcgaa ttccgcattg cagagatatt gtatttaagt gcctagctcg atacaataaa
     cgccatttga ccattcacca cattggtgtg cacctccaag cttgggcaga aatggttgaa
     ctcccgagag tgtcctacac ctaggggaga agcagccaag gggttgtttc ccaccaagga
     cgacccgtct gcgcacaaac ggatgagccc atcagacaaa gacatattca ttctctgctg
     caaacttggc atagctctgc tttgcctggg gctattgggg gaagttgcgg ttcgtgctcg
     cagggctctc acccttgact cttttaatag ctcttctgtg caagattaca atctaaacaa
     ttcggagaac tcgaccttcc tcctgaggca aggaccacag ccaacttcct cttacaagcc
     gcatcgattt tgtccttcag aaatagaaat aagaatgctt gctaaaaatt atatttttac
     caataagacc aatccaatag gtagattatt agttactatg ttaagaaatg aatcattatc
     ttttagtact atttttactc aaattcagaa gttagaaatg ggaatagaaa atagaaagag
     acgctcaacc tcaattgaag aacaggtgca aggactattg accacaggcc tagaagtaaa
     aaagggaaaa aagagtgttt ttgtcaaaat aggagacagg tggtggcaac cagggactta
     taggggacct tacatctaca gaccaacaga tgccccctta ccatatacag gaagatatga
     cttaaattgg gataggtggg ttacagtcaa tggctataaa gtgttatata gatccctccc
     ttttcgtgaa agactcgcca gagctagacc tccttggtgt atgttgtctc aagaagaaaa
     agacgacatg aaacaacagg tacatgatta tatttatcta ggaacaggaa tgcacttttg
     gggaaagatt ttccatacca aggaggggac agtggctgga ctaatagaac attattctgc
     aaaaactcat ggcatgagtt attatgaata gcctttattg gcccaacctt gcggttccca
     gggcttaagt aagtttttgg ttacaaactg ttcttaaaac gaggatgtga gacaagtggt
     ttcctgactt ggtttggtat caaaggttct gatctgagct ctgagtgttc tattttccta
     tgttcttttg gaatttatcc aaatcttatg taaatgctta tgtaaaccaa gatataaaag
     agtgctgatt ttttgagtaa acttgcaaca gtcctaacat tcacctcttg tgtgtttgtg
     tctgttcgcc atcccgtctc cgctcgtcac ttatccttca ctttccagag ggtccccccg
     cagaccccgg cgaccctcag gtcggccgac tgcggcagct ggcgcccgaa cagggaccct
     cggataagtg acccttgtct ctatttctac tatttggtgt ttgtcttgta ttgtctcttt
     cttgtctggc tatcatcaca agagcggaac ggactcacca tagggaccaa gctagcgaat
     cgatagctag cgcgcactag tctcgaggcg ccggcacgcg tacgagatct gtttcgaggg
     atctttgtga aggaacctta cttctgtggt gtgacataat tggacaaact acctacagag
     atttaaagct ctaaggtaaa tataaaattt ttaagtgtat aatgtgttaa actactgatt
     ctaattgttt gtgtatttta gattccaacc tatggaactg atgaatggga gcagtggtgg
     aatgccttta atgaggaaaa cctgttttgc tcagaagaaa tgccatctag tgatgatgag
     gctactgctg actctcaaca ttctactcct ccaaaaaaga agagaaaggt agaagacccc
     aaggactttc cttcagaatt gctaagtttt ttgagtcatg ctgtgtttag taatagaact
     cttgcttgct ttgctattta caccacaaag gaaaaagctg cactgctata caagaaaatt
     atggaaaaat attctgtaac ctttataagt aggcataaca gttataatca taacatactg
     ttttttctta ctccacacag gcatagagtg tctgctatta ataactatgc tcaaaaattg
     tgtaccttta gctttttaat ttgtaaaggg gttaataagg aatatttgat gtatagtgcc
     ttgactagag atcataatca gccataccac atttgtagag gttttacttg ctttaaaaaa
     cctcccacac ctccccctga acctgaaaca taaaatgaat gcaattgttg ttgttaactt
     gtttattgca gcttataatg gttacaaata aagcaatagc atcacaaatt tcacaaataa
     agcatttttt tcactgcatt ctagttgtgg tttgtccaaa ctcatcaatg tatcttatca
     tgtctggatc aacatgcatc attcgccatt caggctgcgc aactgttggg aagggcgatc
     ggtgcgggcc tcttcgctat tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt
     aagttgggta acgccagggt tttcccagtc acgacgttgt aaaacgacgg ccagtgaatt
     cgagctcggt acccggggat cctctagagt cgacctgcag gcatgcaagc ttggcgtaat
     catggtcata gctgtttcct gtgtgaaatt gttatccgct cacaattcca cacaacatac
     gagccggaag cataaagtgt aaagcctggg gtgcctaatg agtgagctaa ctcacattaa
     ttgcgttgcg ctcactgccc gctttccagt cgggaaacct gtcgtgccag ctgcattaat
     gaatcggcca acgcgcgggg agaggcggtt tgcgtattgg gcgctcttcc gcttcctcgc
     tcactgactc gctgcgctcg gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg
     cggtaatacg gttatccaca gaatcagggg ataacgcagg aaagaacatg tgagcaaaag
     gccagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc
     gcccccctga cgagcatcac aaaaatcgac gctcaagtca gaggtggcga aacccgacag
     gactataaag ataccaggcg tttccccctg gaagctccct cgtgcgctct cctgttccga
     ccctgccgct taccggatac ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc
     aatgctcacg ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg
     tgcacgaacc ccccgttcag cccgaccgct gcgccttatc cggtaactat cgtcttgagt
     ccaacccggt aagacacgac ttatcgccac tggcagcagc cactggtaac aggattagca
     gagcgaggta tgtaggcggt gctacagagt tcttgaagtg gtggcctaac tacggctaca
     ctagaaggac agtatttggt atctgcgctc tgctgaagcc agttaccttc ggaaaaagag
     ttggtagctc ttgatccggc aaacaaacca ccgctggtag cggtggtttt tttgtttgca
     agcagcagat tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg
     ggtctgacgc tcagtggaac gaaaactcac gttaagggat tttggtcatg agattatcaa
     aaaggatctt cacctagatc cttttaaatt aaaaatgaag ttttaaatca atctaaagta
     tatatgagta aacttggtct gacagttacc aatgcttaat cagtgaggca cctatctcag
     cgatctgtct atttcgttca tccatagttg cctgactccc cgtcgtgtag ataactacga
     tacgggaggg cttaccatct ggccccagtg ctgcaatgat accgcgagac ccacgctcac
     cggctccaga tttatcagca ataaaccagc cagccggaag ggccgagcgc agaagtggtc
     ctgcaacttt atccgcctcc atccagtcta ttaattgttg ccgggaagct agagtaagta
     gttcgccagt taatagtttg cgcaacgttg ttgccattgc tacaggcatc gtggtgtcac
     gctcgtcgtt tggtatggct tcattcagct ccggttccca acgatcaagg cgagttacat
     gatcccccat gttgtgcaaa aaagcggtta gctccttcgg tcctccgatc gttgtcagaa
     gtaagttggc cgcagtgtta tcactcatgg ttatggcagc actgcataat tctcttactg
     tcatgccatc cgtaagatgc ttttctgtga ctggtgagta ctcaaccaag tcattctgag
     aatagtgtat gcggcgaccg agttgctctt gcccggcgtc aatacgggat aataccgcgc
     cacatagcag aactttaaaa gtgctcatca ttggaaaacg ttcttcgggg cgaaaactct
     caaggatctt accgctgttg agatccagtt cgatgtaacc cactcgtgca cccaactgat
     cttcagcatc ttttactttc accagcgttt ctgggtgagc aaaaacagga aggcaaaatg
     ccgcaaaaaa gggaataagg gcgacacgga aatgttgaat actcatactc ttcctttttc
     aatattattg aagcatttat cagggttatt gtctcatgag cggatacata tttgaatgta
     tttagaaaaa taaacaaata ggggttccgc gcacatttcc ccgaaaagtg ccacctgacg
     tctaagaaac cattattatc atgacattaa cctataaaaa taggcgtatc acgaggccct
     ttcgtc
//