back Return to this vector's summary.
ID   PMB121     preliminary; circular DNA; SYN; 2718 BP.
XX
AC   IG9834;
XX
DT   01-JUL-1995 (Rel. 11, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pMB121 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pMB121, pMB122 from pNIMB
RC   pMB123 from pMB121
RC   pMB124 from pMB122
RA   Siniakov A.N., Serpinsky O.I., Daniliuk N.K., Chizhikov V.E.,
RA   Degtiarev S.Kh.;
RT   "[Plasmids pMB123 and pMB124--vectors for obtaining subfragments of
RT   DNA with random sticky ends]";
RL   Bioorg. Khim. 15:638-647(1989).
XX
RN   [2]
RC   pBBV from oligo
RA   Korobko V.G., Dobrynin B.H., Boldyreva E.F., Severtsova I.V.,
RA   Kolosov M.N.;
RT   "[Rapid method of DNA assembly from synthetic
RT   oligodeoxynucleotides]";
RL   Dokl. Acad. Nauk. Russia 278:1250-1253(1984).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   NM (pMB121)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pNIMB from pUR222)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pNIMB remove EcoRI-BamHI 12bp,
FT                   \ pUR222 1830..oligo/2703bp
FT                   2. oligo 16bp aattctggatgacgcg
FT                   -> pMB121 2719bp"
FT   -               1..1829
FT                   /note="pUR222 1..1829 1829bp
FT                   EcoRI = G^AATTC
FT                   \         aattc..."
FT   -               1830..1845
FT                   /note="aattctggatgacgcg 16bp
FT                   \ ...gacgcg
FT                   BamHI =   G^GATCC
FT                   \           gatcc..."
FT   -               1846..1872
FT                   /note="gatccaagcttgtcgacgcgtcctgca 27bp
FT                   \  ...cctgca
FT                   PstI = CTGCA^G"
FT   -               1873..2718
FT                   /note="pUR222 1855..2700 846bp"
FT   promoter        0..0
FT                   /note="E. coli lacZ PO"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (amp/apr)"
XX
SQ   Sequence 2718 BP; 660 A; 669 C; 706 G; 683 T; 0 other;
     tcgaactgga tctcaacagc ggtaagatcc ttgagagttt tcgccccgaa gaacgttttc
     caatgatgag cacttttaaa gttctgctat gtggcgcggt attatcccgt gttgatgccg
     ggcaagagca actcggtcgc gcgatacact attctcagaa tgacttggtt gagtactcac
     cagtcacaga aaagcatctt acggatggca tgacagtaag agaattatgc agtgctgcca
     taaccatgag tgataacact gcggccaact tacttctgac aacgatcgga ggaccgaagg
     agctaaccgc ttttttgcac aacatggggg atcatgtaac tcgccttgat cgttgggaac
     cggagctgaa tgaagccata ccaaacgacg agcgtgacac cacgatgcct gtagcaatgg
     caacaacgtt gcgcaaacta ttaactggcg aactacttac tctagcttcc cggcaacaat
     taatagactg gatggaggcg gataaagttg caggaccact tctgcgctcg gcccttccgg
     ctggctggtt tattgctgat aaatctggag ccggtgagcg tgggtctcgc ggtatcattg
     cagcactggg gccagatggt aagccctccc gtatcgtagt tatctacacg acggggagtc
     aggcaactat ggatgaacga aatagacaga tcgctgagat aggtgcctca ctgattaagc
     attggtaact gtcagaccaa gtttactcat atatacttta gattgattta aaacttcatt
     tttaatttaa aaggatctag gtgaagatcc tttttgataa tctcatgacc aaaatcccta
     acgtgagttt tcgttccact gagcgtcaga ccccgtagaa aagatcaaag gatcttcttg
     agatcctttt tttctgcgcg taatctgctg cttgcaaaca aaaaaaccac cgctaccagc
     ggtggtttgt ttgccggatc aagagctacc aactcttttt ccgaaggtaa ctggcttcag
     cagagcgcag ataccaaata ctgtccttct agtgtagccg tagttaggcc accacttcaa
     gaactctgta gcaccgccta catacctcgt cctgctaatc ctgttaccag tggctgctgc
     cagtggcgat aagtcgtgtc ttaccgggtt ggactcaaga cgatagttac cggataaggc
     gcagcggtcg ggctgaacgg ggggttcgtg cacacagccc agcttggagc gaacgaccta
     caccgaactg agatacctac agcgtgagct atgagaaagc gccacgcttc ccgaagggag
     aaaggcggac aggtatccgg taagcggcag ggtcggaaca ggagagcgca cgagggagct
     tccaggggga aacgcctggt atctttatag tcctgtcggg tttcgccacc tctgacttga
     gcgtcgattt ttgtgatgct cgtcaggggg gcggagccta tggaaaaacg ccagcaacgc
     ggccttttta cggttcctgg ccttttgctg gccttttgct cacatgttct ttcctgcgtt
     atcccctgat tctgtggata accgtattac cgcctttgag tgagctgata ccgctcgccg
     cagccgaacg accgagcgca gcgagtcagt gagcgaggaa gcggaagagc gccattcgcc
     attcaggcta cgcaactgtt gggaagggcg atcggtgcgg gcctcttcgc tattacgcca
     gctggcgaag gggggatgtg ctgcaaggcg attaagttgg gtaacgccag ggttttccca
     gtcacgacgt tgtaaaacga cggccagtga attctggatg acgcggatcc aagcttgtcg
     acgcgtcctg cagcaattcg taatcatggt catagctgtt tcctgtgtga aattgttatc
     cgctcacaat tccacacaac atacgagccg gaagcataaa gtgtaaagcc tggggtgcct
     aatgagtgag ctaagtcaca ttaattgcgt tgcgctcact gcccgctttc cagtcgggaa
     acctgtcgtg ccagctggat taatgaatcg gccaacgcgc cgggagaggc ggtttgcgta
     ttgggcgcct gatgcggtat tttctcctta cgcatctgtg cggtatttca caccgcatat
     ggtgcactct cagtacaatc tgctctgatg ccgcatagtt aagccagtaa tacactccgc
     tatcgctacg tgactgggtc atggctgcgc cccgacaccc gccaacaccc gctgacgcgc
     cctgatgggc ttgtctgctc ccggcatccg cttacagaca agctgtgacc gtctccggga
     gctgcatgtg tcagaggttt tcaccgtcat caccgaaacg cgcgagacga aagggcctcg
     tgatacgcct atttttatag gttaatgtca tgataataat ggtttcttag acgtcaggtg
     gcacttttcg gggaaatgtg cgcggaaccc ctatttgttt atttttctaa atacattcaa
     atatgtatcc gctcatgaga caataaccct gataaatgct tcaataatat tgaaaaagga
     agagtatgag tattcaacat ttccgtgtcg cccttattcc cttttttgcg gcattttgcc
     ttcctgtttt tgctcaccca gaaacgctgg tgaaagtaaa agatgctgaa gatcagttgg
     gtgcacgagt gggttaca
//