back Return to this vector's summary.
ID   PMB9       preliminary; circular DNA; SYN; 5295 BP.
XX
AC   M13468; IG1088; ATCC37019;
XX
DT   01-FEB-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pMB9 - complete, kil gene.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-138
RC   pEAP1R from pEAP1
RC   pEAP2R from pEAP2
RC   pEAP3 from pEAP1
RC   pEAP4, pEAP4R from pEAP3 & pMB9
RC   pEAP6B from pEAP3 & linker
RC   pACAP2 from pEAP2 & pACYC184
RC   pACAP2R from pEAP2R & pACYC184
RA   Kobayashi T., Kato C., Kudo T., Horikoshi K.;
RT   "Excretion of the penicillinase of an alkalophilic Bacillus sp.
RT   through the Escherichia coli outer membrane is caused by
RT   insertional activation of the kil gene in plasmid pMB9";
RL   J. Bacteriol. 166:728-732(1986).
XX
RN   [2]
RC   pEAP1, pEAP2 from pMB9 & Bacillus penicillinase gene
RA   Kudo T., Kato C., Horikoshi K.;
RT   "Excretion of the penicillinase of an alkalophilic Bacillus sp.
RT   through the Escherichia coli outer membrane";
RL   J. Bacteriol. 156:949-951(1983).
XX
RN   [3]
RC   pMB9 from pMB8 & pSC101
RC   pBR312, pBR26 from pMB9 & pSF2124, TnA/Tn3 amp gene
RC   pBR313, pBR315, pBR316 from pBR312
RC   pBR317, pBR318 from pBR313
RA   Bolivar F., Rodriguez R.L., Betlach M.C., Boyer H.W.;
RT   "Construction and characterization of new cloning vehicles, I.
RT   ampicillin-resistant derivatives of the plasmid pMB9";
RL   Gene 2:75-93(1977).
XX
RN   [4]
RC   [pMB1 from ColE1]
RC   pMB3 from pMB1 & Tn3, amp gene
RC   pMB8 from pMB3
RC   pMB9 from pMB8 & pSC101, tet gene
RC   pBR312 from pMB9 & pSF2124, Tn3
RC   pBR313 from pBR312
RC   pBR318, pBR320 from pBR313
RC   pBR322 from pBR318 & pBR320
RA   Rodriguez R.L., Tait R.C.;
RT   ;
RL   Recombinant DNA Technology An Introduction 0:187-187(1983).
RL   Rodriguez R.L., Tait R.C., Addison-Wesley, Reading MA.
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   ATCC size is 5200 bp.
CC   Medium is 1273 LB plus tetracycline.
CC   NCBI gi: 207849
CC   NM (pMB9)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (Sigma)(ATCC)
CC   HO (E.coli RRI)(E.coli HB101)(E.coli C600)(E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (colicin E1)(Tn3)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. ColE1 6646bp
FT                   -> pMB1 2000bp
FT                   1. pMB1 2000bp
FT                   2. Tn3 1800bp, amp gene
FT                   -> pMB3 3800bp
FT                   1. pMB3 3800bp
FT                   \ atgaggaaaagattttttgtgggaatattcgcgataaacctccttgttgg
FT                   \ atgtcaggctaactatatacgtgatgttcagggagggaccatcgcaccat
FT                   \ cctcctcttctaaactgacggggatcgcggttcagtag
FT                   -> pMB8 3847bp [similar to pVH51]
FT                   1. pMB8/pVH51 EcoRI 3847bp 3846..3846, ori/cat gene
FT                   2. pSC101 EcoRI-BalI 1448bp 9262..9263..1447, tet gene
FT                   -> pMB9 5295bp [unique EcoRI, HindIII, SalI, BamHI]"
FT   -               1..3845
FT                   /note="pVH51 1..3845 3845bp
FT                   EcoRI = G^AATTC"
FT   -               3846..5293
FT                   /note="pSC101 9262..9263..1446 1448bp
FT                   BalI = TGG^CCA
FT                   EcoRI =  G^AATTC"
FT   -               5294..5295
FT                   /note="pVH51 3846..3847 2bp"
FT   CDS             0..0
FT                   /note="ANT E. coli tetracycline resistance gene (tet)"
FT   misc_binding    0..0
FT                   /note="SIT BamHI"
FT   misc_binding    0..0
FT                   /note="SIT HindIII"
FT   misc_binding    0..0
FT                   /note="SIT SalI"
FT   mRNA            0..0
FT                   /note="GEN E. coli imm mRNA [4],[8]"
FT   CDS             0..0
FT                   /note="GEN E. coli colicin E1 immunity protein (imm)"
FT   misc_binding    0..0
FT                   /note="SIT EcoRI"
FT   CDS             1..138
FT                   /note="GEN E. coli kil gene; NCBI gi: 207850."
FT   misc_RNA        0..0
FT                   /note="GEN E. coli RNA II"
FT   misc_RNA        0..0
FT                   /note="GEN E. coli RNA I (3' end +/- 1 bp) [5]"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)
FT                   (+/- 1 bp) [1]"
FT   mRNA            0..0
FT                   /note="GEN E. coli mob mRNA (5' end putative) [4],[8]"
FT   misc_feature    0..0
FT                   /note="SIT E. coli relaxation (nic) cut site [2]"
FT   CDS             0..0
FT                   /note="GEN E. coli mob1 protein; (GTG start codon)"
FT   CDS             0..0
FT                   /note="GEN E. coli RNA I inhibition modulator protein;
FT                   (rom - GTG start codon)"
FT   mRNA            0..0
FT                   /note="GEN E. coli exc mRNA [4],[8]"
FT   CDS             0..0
FT                   /note="GEN E. coli entry exclusion protein 2 (exc2)"
FT   CDS             0..0
FT                   /note="GEN E. coli entry exclusion protein 1 (exc1)"
FT   mRNA            0..0
FT                   /note="GEN E. coli colE1-kil mRNA [8]"
FT   CDS             0..0
FT                   /note="GEN E. coli colicin E1 protein (cea)"
XX
SQ   Sequence 5295 BP; 1237 A; 1305 C; 1510 G; 1243 T; 0 other;
     ttctatgctc ctatattgat aagaataaac ttaatactat aaatgaggtg ttagggattt
     aattattctt tattgatata aaaagtccta gcaatccaaa tgggattgct aggaccaaac
     aaagtagatt atatagcata aataggttta attttgctac gggggcgtta tttaggtttt
     ttcttctttc gaaaaaatct ttctttatga agttaaaagc tatgtattca atagcatatt
     ttgaatatgg acatagaata gtgcttatca ctattgcata tagcatctta tctgacacaa
     ggaaataata cccttcgctg ttttttgtta taaggtatat atatataagt gtgcagtaca
     ggccaaataa aatatttttt atgtagtatc ttaagctcat aaattaaacc tcgccatata
     ttcttttcat tttataagga tcgagttatg aggaaaagat tttttgtggg aatattcgcg
     ataaacctcc ttgttggatg tcaggctaac tatatacctg atgttcaggg agggaccatc
     gcaccatcct cctcttctaa actgacgggg atcgcggttc agtagaaaag attaaaggat
     cttcttgaga tccttttttt ctgcgcgtaa tctgctgctt gcaaacaaaa aaaccaccgc
     taccaacggt ggtttgtttg ccggatcaag agctaccaac tctttttccg aaggtaactg
     gcttcagcag agcgcagata ccaaatactg tccttctagt gtagccgtag tcgggccact
     acttcaagaa ctctgtagca ccgtttgtgc catcatcgct ctgctaatcc ggttaccagt
     ggctgctgcc agtggcgtta aggcgtgcct taccgggttg gactcaagac gatagttacc
     ggataaggcg cagcggtcgg gctgaacggg gggttcgtgc acacagccca gcttggagcg
     aacgacctac accgaactga gataccaaca gcgtgagcta tgagaaagcg ccacgcttcc
     cgaagggaga aaggcggaca ggtatccggt aagcggcagg gtcggaacag gagagcgcac
     gagggagctt ccagggggaa acgcctggta gctttatagt cctgtcgggt ttcgccacct
     ctgacttgag cgtctatttt tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc
     ctgctacgtg gccttcttcc tgttcctggt cttttgctca catgttcttt ccggccttat
     cccctgattc tgtggataac tgtgttaccg tttttgtgtg agtcagtacc gctcgccgca
     gtcgaacgac cgagcgtagc gagtcagtga gcgaggaagc ggaaaagcgc ctggacgtgc
     attttctcct tacgcatctg tgcggcattt cacacccggc atggcgtact tttcatacaa
     tccgcactga tgccgcatgg ttaagccagt atacactccg ctatcgctac gtgactgggt
     cagggctgcg ccccgacacc cgctaaaacc tgctgacgcg ccctgacggg cttgtcagct
     cccggcatcc gctcacagac aagctgtgac cgtctccggg agctgcatgt gtcagaggtt
     ttcaccgtca tccccgaaac gtgcgaggca gctgcggtaa agctcatcgg cgtggtcgtg
     aagcgattca caaatatcgg cctgttcatc tgcgtccagt tcgttgagct tctccagcag
     cgttaatgtc tggcttctga taaagcgggc catgttaagg gcggtttttt cctgtttagt
     cactgatgcc tccgtgtaag ggggatttct gttcatgggg taatgatacc gatgaaacgc
     gagaggatgc tcacaatacg ggttactgat gatgaacatg cccggttact tgaacgctgt
     gagggtaaac aactggcggt atggatgcgg cgggtctgcc tgggggagcc ggttgcccgt
     tccggaaaac tgccgacact ggcaccgccg ttactgcgtc agctggccgc catcggaaat
     aacctgaatc agacagcccg taaggtgaac agcgggcagt ggtcttccgg tgaccgggtt
     caggtggtgg ccgcactgat ggccatcggg gatgagctgc gccggctgcg tctggctgtc
     agggaacagg gggcgcggga tgatagttaa atttcatgcc aggggaaaag gtggtggcag
     tggtccggtt gattacctgc tggggaggga gcgtaaccgc gaaggcgcaa cggtgcttca
     gggtataccg gaagaagtcc gggaactcat cgatgccacg ccatttgcga agaaatacac
     gtccggtgtt ctgtcgttcg cggagaagga gctgccgccg ggaggacgtg aaaaagtgat
     ggcgagcttt gagcgtgtac tgatgcccgg tctcgaaaaa aatcagtaca gcatcctgtg
     ggtggagcac caggacaagg gacggcttga gctgaatttt gtcattccga acatggagct
     acagaccgga aaacgcctcc agccgtacta cgaccgcgca gacaggccta gaattgatgc
     ttggcagacg ctgttaaatc accattacgg gctgcatgac ccgaacgccc cggagaaccg
     caggacgctg acactccctg ataacctgcc tgaaacgaaa caggcgcttg ctgagggcgt
     cacgcgaggt atagatgcac tttaccatgc cggagagata aaaggccgtc aggatgtgat
     tcaggcgctc actgaggcgg ggctggaagt ggtcagggtg acgcgaagca gtatcagcat
     tgcagatccg aacggcggga agaatatcag gctgaaagga gcattttatg agcaatcttt
     tgcagacggg cgcggagttc gagaaaaagc tgaaagagag agccgaatct acagagaaaa
     tgctgaacaa cgagttcagg aggctcggcg aatctgtaag cgaggctgtg acatcaaacg
     agacgaaaat cagagacgct atagccctgt tcacagcctc gacagaggaa tcgctggaaa
     aacaccggga aggggtgaaa gaggcgatga tgcagcacag gagggacgtg ttaaagctgg
     cagggaatac gggcatgatg ttactgggga tagtctttct cctgtttacc gcgagtggcg
     ggacgctctg gtatcttgga gggaggatac aggcgaacct ggaagaaatc aggaagcagg
     aagagacatt gcagaaactg aacgcgaaga catggggcgt ggagtttgtg caggacggga
     acaggaaatt ccttgtcctt ccgtacggga aatcagcgga ggtgattccc tttcagggga
     aagagtgggt aatggaactt ggatgaagaa agagtgaaca tgatggttcc gccatggggc
     gggcggtcat ggagttgtca ctggcagatt tacctatgac ccagcaaaac atcatcgaca
     agctggaacg gtaccggaag gaaacgggaa acgtgatagg taagggtgtg aacgggatgc
     agctgagata gtcaggaagg gtagtaaagc tgtgaagtag gcacaaaaaa cccggcgcgg
     tggccggttg ttaaagctca atatcaacta tgaaaagttt actaatagcc ccttttctaa
     ctgctgcttt ggcagttact tttaccgctg actcagtact tagacccgtt gacagaaaac
     gactaagtga aatgagatac gggttgtctg cctttgaagc agatggatcg cttatttgtg
     ctgagatgcg cttatctgaa tcatcacctt ctataatgac tttagcggtc attcggtgag
     cgtcgaattc tcatgtttga cagcttatca tcgataagct ttaatgcggt agtttatcac
     agttaaattg ctaacgcagt caggcaccgt gtatgaaatc taacaatgcg ctcatcgtca
     tcctcggcac cgtcaccctg gatgctgtag gcataggctt ggttatgccg gtactgccgg
     gcctcttgcg ggatatcgtc cattccgaca gcatcgccag tcactatggc gtgctgctag
     cgctatatgc gttgatgcaa tttctatgcg cacccgttct cggagcactg tccgaccgct
     ttggccgccg cccagtcctg ctcgcttcgc tacttggagc cactatcgac tacgcgatca
     tggcgaccac acccgtcctg tggatcctct acgccggacg catcgtggcc ggcatcaccg
     gcgccacagg tgcggttgct ggcgcctata tcgccgacat caccgatggg gaagatcggg
     ctcgccactt cgggctcatg agcgcttgtt tcggcgtggg tatggtggca ggccccgtgg
     ccgggggact gttgggcgcc atctccttgc atgcaccatt ccttgcggcg gcggtgctca
     acggcctcaa cctactactg ggctgcttcc taatgcagga gtcgcataag ggagagcgtc
     gaccgatgcc cttgagagcc ttcaacccag tcagctcctt ccggtgggcg cggggcatga
     ctatcgtcgc cgcacttatg actgtcttct ttatcatgca actcgtagga caggtgccgg
     cagcgctctg ggtcattttc ggcgaggacc gctttcgctg gagcgcgacg atgatcggcc
     tgtcgcttgc ggtattcgga atcttgcacg ccctcgctca agccttcgtc actggtcccg
     ccaccaaacg tttcggcgag aagcaggcca ttatcgccgg catggcggcc gacgcgctgg
     gctacgtctt gctggcgttc gcgacgcgag gctggatggc cttccccatt atgattcttc
     tcgcttccgg cggcatcggg atgcccgcgt tgcaggccat gctgtccagg caggtagatg
     acgaccatca gggacagctt caaggatcgc tcgcggctct taccagccta acttcgatca
     ctggaccgct gatcgtcacg gcgatttatg ccgcctcggc gagcacatgg aacgggttgg
     catggattgt aggcgccgcc ctataccttg tctgcctccc cgcgttgcgt cgcggtgcat
     ggagccgggc cacctcgacc tgaatggaag ccggcggcac ctcgctaacg gattcaccac
     tccaagaatt ggagccaatc aattcttgcg gagaactgtg aatgcgcaaa ccaacccttg
     gcagaacata tccatcgcgt ccgccatctc cagcagccgc acgcggcgca tctcgggcag
     cgttgggtcc tggaa
//