back Return to this vector's summary.
ID   PMEP4      preliminary; circular DNA; SYN; 10440 BP.
XX
AC   IG1089; K01383;
XX
DT   01-FEB-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pMEP4 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pcDV1/S2 from pcDV1 & linker
RC   pRSVCAT/H2 from pRSVcat & linker
RC   [pBT from BT gene]
RC   pRSV/BT from pRSVCAT/H2 & pBT
RC   pRSVPA1 from pRSV/BT & pcDV1/S2
RC   pRSVPA2 from pRSVPA1 & linker
RC   p220.2 from p201
RC   p220.2/B- from p220.2
RC   pREP2 from pRSVPA2 & p220.2/B-
RC   pREP3 from pREP2
RC   p220.2/XS from p220.2/B-
RC   pHS1PA4 from pRSVPA2
RC   pMEP4 from p220.2/XS & pHS1PA4
RC   pRSVCAT-B2 from pRSVcat & linker
RC   pRSVCAT-B2K from pRSVCAT-B2 & linker
RC   pREP4 from pRSVCAT-B2K & pMEP4
RC   pREP5 from pREP4 & oligo
RA   Groger R.K., Morrow D.M., Tykocinski M.L.;
RT   "Directional antisense and sense cDNA cloning using Epstein-Barr
RT   virus episomal expression vectors";
RL   Gene 81:285-294(1989).
XX
CC   NM (pMEP4)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (Invitrogen)
CC   HO (E.coli NM522)(E.coli INValphaF')(mammal)
CC   CP ()
CC   FN (expression)
CC   SE ()
CC   PA (EBV)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pUC12 2680bp
FT                   2. EBV, oriP
FT                   3. E. coli 1142bp, hyg gene
FT                   4. HSV 1, tk gene terminator/#X14112
FT                   -> pHEBo2
FT                   1. pHEBo2
FT                   2. EBV, EBNA-1 gene
FT                   -> p201
FT                   1. p201 NarI, HSV1 tk gene/#X14112
FT                   2. pUC12 BamHI-XbaI-SalI-PstI-HindIII 27bp 249..276,
FT                   \ MCS
FT                   -> p220.2
FT                   1. p220.2 BamHI
FT                   Klenow
FT                   -> p220.2/B-
FT                   1. p220.2/B- HindIII
FT                   Klenow
FT                   -> p220.2/B-H- [NheI at HindIII]
FT                   1. p220.2/B-H- SalI-NheI
FT                   Klenow:Klenow
FT                   -> p220.2/XS
FT                   1. pRSVcat NdeI 5028bp, 3' to RSV LTR
FT                   \ pSV2-cat 556..556
FT                   Klenow
FT                   HindIII linker 6bp aagctt
FT                   -> pRSVCAT/H2 5030bp [HindIII-RSV LTR-HindIII]
FT                   1. BT gene
FT                   -> pBT
FT                   1. pRSVCAT/H2 small HindIII-HindIII 500bp, RSV 3' LTR
FT                   2. pBT HindIII
FT                   phosphatase
FT                   -> pRSV/BT
FT                   1. pcDV1 Tth111I 3053bp 367..367,
FT                   \ 3' to SV40 polyA
FT                   Klenow
FT                   SalI linker 6bp gtcgac
FT                   -> pcDV1/S2 3060bp
FT                   1. pRSV/BT small ClaI-BamHI 500bp, RSV 3' LTR
FT                   2. pcDV1/S2 large ClaI-BamHI 2629bp, ori/SV40 polyA
FT                   \ pcDX 2955..3053..2531
FT                   phosphatase
FT                   -> pRSVPA1 3100bp
FT                   1. pRSVPA1 EcoRV 3100bp, RSV 3' LTR
FT                   KpnI linker 6bp ggtacc
FT                   -> pRSVPA2 3100bp
FT                   1. pMSG SmaI 7626bp 9..9, 5' to MMTV 5' LTR
FT                   HindIII linker 6bp aagctt
FT                   -> pMSGderivative 7630bp
FT                   1. pRSVPA2 remove small HindIII-HindIII, RSV LTR
FT                   2. pMSGderivative HindIII-HindIII, MMTV 5' LTR
FT                   -> pMMTVPA2
FT                   1. pHS1
FT                   2. Tn9 TaqI-TaqI 773bp 215..988, cat gene/#V00622
FT                   -> pHS1CAT
FT                   1. pHS1CAT BamHI, 3' to hMTIIA gene promoter
FT                   KpnI linker 6bp ggtacc
FT                   -> pHS1CATderivative
FT                   1. pMMTVPA2 HindIII-KpnI, MMTV 5' LTR
FT                   2. pHS1CATderivative HindIII-KpnI, hMTIIA gene prom
FT                   -> pHS1PA2
FT                   1. pRSVPA2 small SalI-SalI 500bp, RSV LTR/SV40 polyA
FT                   2. p220.2/B- SalI
FT                   -> pREP2
FT                   1. pREP2 remove small KpnI-BamHI
FT                   2. oligo KpnI-PvuI-NheI-NotI-XhoI-SfiI-BarI-BamHI 35bp
FT                   \ cagctgctagcggccgctcgaggccggcaaggccg
FT                   -> pREP3
FT                   1. pHS1PA2 remove small KpnI-BamHI
FT                   2. pREP3 KpnI-BamHI, MCS
FT                   -> pHS1PA3
FT                   1. pHS1PA3 ClaI-HindIII, 5' to hMTIIA gene promoter
FT                   Klenow:Klenow
FT                   BglII linker 6bp agatct
FT                   -> pHSV1BgII
FT                   1. pHSV1BgII NheI
FT                   Klenow:Klenow
FT                   NheI-HindIII-NheI linker 18bp gctagcaagcttgctagc
FT                   -> pHS1PA4
FT                   1. p220.2/XS large SalI-SalI, almost complete
FT                   2. pHS1PA4 small SalI-SalI, hMTIIA promoter/SV40 polyA
FT                   -> pMEP4 10440bp"
FT   misc_binding    1..1
FT                   /note="SIT XbaI"
FT   promoter        0..0
FT                   /note="PRO human metallothionein IIa gene"
FT   misc_binding    44..44
FT                   /note="SIT BglII"
FT   misc_binding    0..0
FT                   /note="MCS
FT                   KpnI-PvuII-NheI-HindIII-NheI-NotI-XhoI-SfiI-BamHI"
FT   polyA_signal    0..0
FT                   /note="PLA SV40 early gene"
FT   polyA_signal    0..0
FT                   /note="PLA SV40 thymidine kinase (TK) gene"
FT   CDS             complement(0..0)
FT                   /note="ANT E. coli hygromycin phosphotransferase gene;
FT                   hygromycin resistance gene (hyg)"
FT   promoter        complement(0..0)
FT                   /note="PRO SV40 thymidine kinase (TK) gene"
FT   misc_binding    3005..3005
FT                   /note="SIT BstBI"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             complement(0..0)
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   misc_binding    5515..5515
FT                   /note="SIT ClaI"
FT   misc_binding    5661..5661
FT                   /note="SIT StuI"
FT   CDS             0..0
FT                   /note="GEN Epstein-Barr virus nuclear antigen gene
FT                   (EBNA-1)"
FT   misc_binding    7366..7366
FT                   /note="SIT SacI"
FT   misc_binding    8136..8136
FT                   /note="SIT SphI"
FT   rep_origin      0..0
FT                   /note="ORI Epstein-Barr virus (EBV) oriP"
FT   misc_binding    9795..9795
FT                   /note="SIT EcoRV"
XX
SQ   Sequence 10440 BP; 2497 A; 2635 C; 3041 G; 2267 T; 0 other;
     tctagaggtc gaccaattct catgtttgac agcttatcat cgcagatctg agcttgtggc
     ttcttctcct tactcttcct cctccttggt gtctgtatgt tagagggccg ttagcatctg
     catctgctgg ggcctggtcg cattcacctg ctctgccact cactggctgt gtgactctgc
     agaaattaac ttctctggac ctggcagttt ctcctctcta caatgagaat actggagagt
     ccttatctta tgggttgcta cagaattaag tgacatctca cacacaacac acttcctaca
     gtccctgtta cacgctaaaa gtactcaact agcttcggat acgtcatcag caaccacccc
     acgggttact gtgatgctgc acaattatta agccctggct gctacagagt tgtaacctgt
     ctgcacttcc aaccggcgcc gcaagcagca ttcccagtcc cgtttcaccc gcgcgctaac
     ggctcagttc gagtacagga caggagggag gggagctgtg cacacggcgg aggcgcacgg
     cgtgggcacc cagcacccgg tacactgtgt cctcccgctg cacccagccc cttcagcccg
     aggcgtcccc gaggcgcaac tgggccgcct tcaggggaac tgaccgcccg cggcccgtgt
     gcagagccgg gtgcgcccgg cccagtgcgc gcggccgggt gtttcgcttg gagccgcaag
     tgacttctag cgcggggcgt gtgcagcacg gccggggcgg ggcttttgca ctcgtcccgg
     ctctttctag ctataaacac tgcttgccgc gctgcactcc accacgcctc ctccaagtcc
     cagcgaaccc gcgtgcaacc tgtcccgact ctagccgcct cttcagctca cggagggtac
     cagctgctag caagcttgct agcggccgct cgaggccggc aaggccggat ccagacatga
     taagatacat tgatgagttt ggacaaacca caactagaat gcagtgaaaa aaatgcttta
     tttgtgaaat ttgtgatgct attgctttat ttgtaaccat tataagctgc aataaacaag
     ttaacaacaa caattgcatt cattttatgt ttcaggttca gggggaggtg gggaggtttt
     ttaaagcaag taaaacctct acaaatgtgg tatggctgat tatgatccgg ctgcctcgcg
     cgtttcggtg atgacggtga aaacctctga cacatgcagc tcccggagac ggtcacagct
     tgtctgtaag cggatgccgg gagcagacaa gcccgtcagg gcgcgtcagc gggtgttggc
     gggtgtcggg gcgcagccat gaccggtcga cggcactggg cgccagaaat ccgcgcggtg
     gtttttgggg gtcgggggtg tttggcagcc acagacgccc ggtgttcgtg tcgcgccagt
     acatgcggtc catgcccagg ccatccaaaa accatgggtc tgtctgctca gtccagtcgt
     ggaccagacc ccacgcaacg cccaaaataa taacccccac gaaccataaa ccattcccca
     tgggggaccc cgtccctaac ccacggggcc agtggctatg gcagggcctg ccgccccgac
     gttggctgcg agccctgggc cttcacccga acttgggggg tggggtgggg aaaaggaaga
     aacgcgggcg tattggcccc aatggggtct cggtggggta tcgacagagt gccagccctg
     ggaccgaacc ccgcgtttat gaacaaacga cccaacaccc gtgcgtttta ttctgtcttt
     ttattgccgt catagcgcgg gttccttccg gtattgtctc cttccgtgtt tcagttagcc
     tcccccatct cccctattcc tttgccctcg gacgagtgct ggggcgtcgg tttccactat
     cggcgagtac ttctacacag ccatcggtcc agacggccgc gcttctgcgg gcgatttgtg
     tacgcccgac agtcccggct ccggatcgga cgattgcgtc gcatcgaccc tgcgcccaag
     ctgcatcatc gaaattgccg tcaaccaagc tctgatagag ttggtcaaga ccaatgcgga
     gcatatacgc ccggagccgc ggcgatcctg caagctccgg atgcctccgc tcgaagtagc
     gcgtctgctg ctccatacaa gccaaccacg gcctccagaa gaagatgttg gcgacctcgt
     attgggaatc cccgaacatc gcctcgctcc agtcaatgac cgctgttatg cggccattgt
     ccgtcaggac attgttggag ccgaaatccg cgtgcacgag gtgccggact tcggggcagt
     cctcggccca aagcatcagc tcatcgagag cctgcgcgac ggacgcactg acggtgtcgt
     ccatcacagt ttgccagtga tacacatggg gatcagcaat cgcgcatatg aaatcacgcc
     atgtagtgta ttgaccgatt ccttgcggtc cgaatgggcc gaacccgctc gtctggctaa
     gatcggccgc agcgatcgca tccatggcct ccgcgaccgg ctgcagaaca gcgggcagtt
     cggtttcagg caggtcttgc aacgtgacac cctgtgcacg gcgggagatg caataggtca
     ggctctcgct gaattcccca atgtcaagca cttccggaat cgggagcgcg gccgatgcaa
     agtgccgata aacataacga tctttgtaga aaccatcggc gcagctattt acccgcagga
     catatccacg ccctcctaca tcgaagctga aagcacgaga ttcttcgccc tccgagagct
     gcatcaggtc ggagacgctg tcgaactttt cgatcagaaa cttctcgaca gacgtcgcgg
     tgagttcagg ctttttcata tctcattgcc cgggatctgc ggcacgctgt tgacgctgtt
     aagcgggtcg ctgcagggtc gctcggtgtt cgaggccaca cgcgtcacct taatatgcga
     agtggacctg ggaccgcgcc gccccgactg catctgcgtg ttcgaattcg ccaatgacaa
     gacgctgggc ggggtttgtg tcatcataga actaaagaca tgcaaatata tttcttccgg
     ggacaccgcc agcaaacgcg agcaacgggc cacggggatg aagcagggca tggcggccga
     cgcgctgggc tacgtcttgc tggcgttcgc gacgcgaggc tggatggcct tccccattat
     gattcttctc gcttccggcg gcatcgggat gcccgcgttg caggccatgc tgtccaggca
     ggtagatgac gaccatcagg gacagcttca aggatcgctc gcggctctta ccagcctaac
     ttcgatcact ggaccgctga tcgtcacggc gatttatgcc gcctcggcga gcacatggaa
     cgggttggca tggattgtag gcgccgccct ataccttgtc tgcctccccg cgttgcgtcg
     cggtgcatgg agccgggcca cctcgacctg aatggaagcc ggcggcacct cgctaacgga
     ttcaccactc caagaattgg agccaatcaa ttcttgcgga gaactgtgaa tgcgcaaacc
     aacccttggc agaacatatc catcgcgtcc gccatctcca gcagccgcac gcggcgcagc
     aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg ctccgccccc
     ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg acaggactat
     aaagatacca ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt ccgaccctgc
     cgcttaccgg atacctgtcc gcctttctcc cttcgggaag cgtggcgctt tctcatagct
     cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc caagctgggc tgtgtgcacg
     aaccccccgt tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt gagtccaacc
     cggtaagaca cgacttatcg ccactggcag cagccactgg taacaggatt agcagagcga
     ggtatgtagg cggtgctaca gagttcttga agtggtggcc taactacggc tacactagaa
     ggacagtatt tggtatctgc gctctgctga agccagttac cttcggaaaa agagttggta
     gctcttgatc cggcaaacaa accaccgctg gtagcggtgg tttttttgtt tgcaagcagc
     agattacgcg cagaaaaaaa ggatctcaag aagatccttt gatcttttct acggggtctg
     acgctcagtg gaacgaaaac tcacgttaag ggattttggt catgagatta tcaaaaagga
     tcttcaccta gatcctttta aattaaaaat gaagttttaa atcaatctaa agtatatatg
     agtaaacttg gtctgacagt taccaatgct taatcagtga ggcacctatc tcagcgatct
     gtctatttcg ttcatccata gttgcctgac tccccgtcgt gtagataact acgatacggg
     agggcttacc atctggcccc agtgctgcaa tgataccgcg agacccacgc tcaccggctc
     cagatttatc agcaataaac cagccagccg gaagggccga gcgcagaagt ggtcctgcaa
     ctttatccgc ctccatccag tctattaatt gttgccggga agctagagta agtagttcgc
     cagttaatag tttgcgcaac gttgttgcca ttgctgcagg catcgtggtg tcacgctcgt
     cgtttggtat ggcttcattc agctccggtt cccaacgatc aaggcgagtt acatgatccc
     ccatgttgtg caaaaaagcg gttagctcct tcggtcctcc gatcgttgtc agaagtaagt
     tggccgcagt gttatcactc atggttatgg cagcactgca taattctctt actgtcatgc
     catccgtaag atgcttttct gtgactggtg agtactcaac caagtcattc tgagaatagt
     gtatgcggcg accgagttgc tcttgcccgg cgtcaacacg ggataatacc gcgccacata
     gcagaacttt aaaagtgctc atcattggaa aacgttcttc ggggcgaaaa ctctcaagga
     tcttaccgct gttgagatcc agttcgatgt aacccactcg tgcacccaac tgatcttcag
     catcttttac tttcaccagc gtttctgggt gagcaaaaac aggaaggcaa aatgccgcaa
     aaaagggaat aagggcgaca cggaaatgtt gaatactcat actcttcctt tttcaatatt
     attgaagcat ttatcagggt tattgtctca tgagcggata catatttgaa tgtatttaga
     aaaataaaca aataggggtt ccgcgcacat ttccccgaaa agtgccacct gacgtctaag
     aaaccattat tatcatgaca ttaacctata aaaataggcg tatcacgagg ccctttcgtc
     ttcaagaatt ctcatgtttg acagcttatc atcgataagc tgatcctcac aggccgcacc
     cagcttttct tccgttgccc cagtagcatc tctgtctggt gaccttgaag aggaagagga
     ggggtcccga gaatccccat ccctaccgtc cagcaaaaag ggggacgagg aatttgaggc
     ctggcttgag gctcaggacg caaatcttga ggatgttcag cgggagtttt ccgggctgcg
     agtaattggt gatgaggacg aggatggttc ggaggatggg gaattttcag acctggatct
     gtctgacagc gaccatgaag gggatgaggg tgggggggct gttggagggg gcaggagtct
     gcactccctg tattcactga gcgtcgtcta ataaagatgt ctattgatct cttttagtgt
     gaatcatgtc tgacgagggg ccaggtacag gacctggaaa tggcctagga gagaagggag
     acacatctgg accagaaggc tccggcggca gtggacctca aagaagaggg ggtgataacc
     atggacgagg acggggaaga ggacgaggac gaggaggcgg aagaccagga gccccgggcg
     gctcaggatc agggccaaga catagagatg gtgtccggag accccaaaaa cgtccaagtt
     gcattggctg caaagggacc cacggtggaa caggagcagg agcaggagcg ggaggggcag
     gagcaggagg ggcaggagca ggaggagggg caggagcagg aggaggggca ggaggggcag
     gaggggcagg aggggcagga gcaggaggag gggcaggagc aggaggaggg gcaggagggg
     caggaggggc aggagcagga ggaggggcag gagcaggagg aggggcagga ggggcaggag
     caggaggagg ggcaggaggg gcaggagggg caggagcagg aggaggggca ggagcaggag
     gaggggcagg aggggcagga gcaggaggag gggcaggagg ggcaggaggg gcaggagcag
     gaggaggggc aggagcagga ggggcaggag gggcaggagg ggcaggagca ggaggggcag
     gagcaggagg aggggcagga ggggcaggag gggcaggagc aggaggggca ggagcaggag
     gggcaggagc aggaggggca ggagcaggag gggcaggagg ggcaggagca ggaggggcag
     gaggggcagg agcaggaggg gcaggagggg caggagcagg aggaggggca ggaggggcag
     gagcaggagg aggggcagga ggggcaggag caggaggggc aggaggggca ggagcaggag
     gggcaggagg ggcaggagca ggaggggcag gaggggcagg agcaggagga ggggcaggag
     caggaggggc aggagcagga ggtggaggcc ggggtcgagg aggcagtgga ggccggggtc
     gaggaggtag tggaggccgg ggtcgaggag gtagtggagg ccgccggggt agaggacgtg
     aaagagccag ggggggaagt cgtgaaagag ccagggggag aggtcgtgga cgtggagaaa
     agaggcccag gagtcccagt agtcagtcat catcatccgg gtctccaccg cgcaggcccc
     ctccaggtag aaggccattt ttccaccctg taggggaagc cgattatttt gaataccacc
     aagaaggtgg cccagatggt gagcctgacg tgcccccggg agcgatagag cagggccccg
     cagatgaccc aggagaaggc ccaagcactg gaccccgggg tcagggtgat ggaggcaggc
     gcaaaaaagg agggtggttt ggaaagcatc gtggtcaagg aggttccaac ccgaaatttg
     agaacattgc agaaggttta agagctctcc tggctaggag tcacgtagaa aggactaccg
     acgaaggaac ttgggtcgcc ggtgtgttcg tatatggagg tagtaagacc tccctttaca
     acctaaggcg aggaactgcc cttgctattc cacaatgtcg tcttacacca ttgagtcgtc
     tcccctttgg aatggcccct ggacccggcc cacaacctgg cccgctaagg gagtccattg
     tctgttattt catggtcttt ttacaaactc atatatttgc tgaggttttg aaggatgcga
     ttaaggacct tgttatgaca aagcccgctc ctacctgcaa tatcagggtg actgtgtgca
     gctttgacga tggagtagat ttgcctccct ggtttccacc tatggtggaa ggggctgccg
     cggagggtga tgacggagat gacggagatg aaggaggtga tggagatgag ggtgaggaag
     ggcaggagtg atgtaacttg ttaggagacg ccctcaatcg tattaaaagc cgtgtattcc
     cccgcactaa agaataaatc cccagtagac atcatgcgtg ctgttggtgt atttctggcc
     atctgtcttg tcaccatttt cgtcctccca acatggggca attgggcata cccatgttgt
     cacgtcactc agctccgcgc tcaacacctt ctcgcgttgg aaaacattag cgacatttac
     ctggtgagca atcagacatg cgacggcttt agcctggcct ccttaaattc acctaagaat
     gggagcaacc agcatgcagg aaaaggacaa gcagcgaaaa ttcacgcccc cttgggaggt
     ggcggcatat gcaaaggata gcactcccac tctactactg ggtatcatat gctgactgta
     tatgcatgag gatagcatat gctacccgga tacagattag gatagcatat actacccaga
     tatagattag gatagcatat gctacccaga tatagattag gatagcctat gctacccaga
     tataaattag gatagcatat actacccaga tatagattag gatagcatat gctacccaga
     tatagattag gatagcctat gctacccaga tatagattag gatagcatat gctacccaga
     tatagattag gatagcatat gctatccaga tatttgggta gtatatgcta cccagatata
     aattaggata gcatatacta ccctaatctc tattaggata gcatatgcta cccggataca
     gattaggata gcatatacta cccagatata gattaggata gcatatgcta cccagatata
     gattaggata gcctatgcta cccagatata aattaggata gcatatacta cccagatata
     gattaggata gcatatgcta cccagatata gattaggata gcctatgcta cccagatata
     gattaggata gcatatgcta tccagatatt tgggtagtat atgctaccca tggcaacatt
     agcccaccgt gctctcagcg acctcgtgaa tatgaggacc aacaaccctg tgcttggcgc
     tcaggcgcaa gtgtgtgtaa tttgtcctcc agatcgcagc aatcgcgccc ctatcttggc
     ccgcccacct acttatgcag gtattccccg gggtgccatt agtggttttg tgggcaagtg
     gtttgaccgc agtggttagc ggggttacaa tcagccaagt tattacaccc ttattttaca
     gtccaaaacc gcagggcggc gtgtgggggc tgacgcgtgc ccccactcca caatttcaaa
     aaaaagagtg gccacttgtc tttgtttatg ggccccattg gcgtggagcc ccgtttaatt
     ttcgggggtg ttagagacaa ccagtggagt ccgctgctgt cggcgtccac tctctttccc
     cttgttacaa atagagtgta acaacatggt tcacctgtct tggtccctgc ctgggacaca
     tcttaataac cccagtatca tattgcacta ggattatgtg ttgcccatag ccataaattc
     gtgtgagatg gacatccagt ctttacggct tgtccccacc ccatggattt ctattgttaa
     agatattcag aatgtttcat tcctacacta gtatttattg cccaaggggt ttgtgagggt
     tatattggtg tcatagcaca atgccaccac tgaacccccc gtccaaattt tattctgggg
     gcgtcacctg aaaccttgtt ttcgagcacc tcacatacac cttactgttc acaactcagc
     agttattcta ttagctaaac gaaggagaat gaagaagcag gcgaagattc aggagagttc
     actgcccgct ccttgatctt cagccactgc ccttgtgact aaaatggttc actaccctcg
     tggaatcctg accccatgta aataaaaccg tgacagctca tggggtggga gatatcgctg
     ttccttagga cccttttact aaccctaatt cgatagcata tgcttcccgt tgggtaacat
     atgctattga attagggtta gtctggatag tatatactac tacccgggaa gcatatgcta
     cccgtttagg gttaacaagg gggccttata aacactattg ctaatgccct cttgagggtc
     cgcttatcgg tagctacaca ggcccctctg attgacgttg gtgtagcctc ccgtagtctt
     cctgggcccc tgggaggtac atgtccccca gcattggtgt aagagcttca gccaagagtt
     acacataaag gcaatgttgt gttgcagtcc acagactgca aagtctgctc caggatgaaa
     gccactcagt gttggcaaat gtgcacatcc atttataagg atgtcaacta cagtcagaga
     acccctttgt gtttggtccc cccccgtgtc acatgtggaa cagggcccag ttggcaagtt
     gtaccaacca actgaaggga ttacatgcac tgccccgaat acaaaacaaa agcgctcctc
     gtaccagcga agaaggggca gagatgccgt agtcaggttt agttcgtccg gcggcggggc
//