back Return to this vector's summary.
ID   PMHNEO     preliminary; circular DNA; SYN; 5840 BP.
XX
AC   L07041;
XX
DT   03-FEB-1994 (Rel. 8, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Eukaryote/E. coli plasmid vector pMHNeo - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-5840
RC   pFNeo from pSV2-neo & SFFV-LTR
RC   pMH-Neo from pFNeo & oligo
RA   Hahn W.C., Menzin E., Saito T., Germain R.N., Bierer B.E.;
RT   "The complete sequence of plasmids pFNeo and pMH-Neo: convenient
RT   expression vectors for high-level expression of eukaryotic genes in
RT   hematopoietic cell lines";
RL   Gene 127:267-268(1993).
XX
CC   NM (pMHNeo)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)(eukaryote)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA ()
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pFNeo HindIII 5846bp 3228..3228
FT                   2. oligo MluI 32bp ggcctaggcttttgcaaaacgcgtcacgctgc
FT                   -> plasmid 5878bp
FT                   1. plasmid BamHI 5878bp 1055..1055
FT                   2. oligo XhoI-EcoRI-BamHI 33bp
FT                   \ ctcatcaatgaattctctcgagtctggatcctc
FT                   -> plasmid2 5911bp
FT                   1. plasmid2 StuI 5911bp 3249..3249
FT                   2. oligo Eco47III 30bp cgttttcggatcgcgaggttttttcggagg
FT                   -> plasmid3 5941bp
FT                   1. plasmid3 EcoRI 5941bp 2..2
FT                   2. oligo EcoRV 34bp gacttattggcaaagatatcatcacgaaagggcc
FT                   -> plasmid4 5975bp
FT                   1. plasmid4 SalI 5975bp
FT                   2. oligo HindIII-SalI 23bp acccgctggcaagcttacctccc
FT                   -> pMHNeo 5840bp"
FT   LTR             1..1023
FT                   /note="spleen focus forming virus LTR and
FT                   contiguous sequences"
FT   CDS             0..0
FT                   /note="ANT E. coli neomycin phosphotransferase gene
FT                   (NPT); neomycin resistance gene (neo);
FT                   G418 resistance gene (G418)"
XX
SQ   Sequence 5840 BP; 1459 A; 1517 C; 1410 G; 1454 T; 0 other;
     gatatctttg ccaataagtc atccgttttg ccacaataac ttcttaactt agaagagcga
     atgctgactc acaggttatc atttatgagc acatgcgggt ttattttcgt cgattcctct
     gtatccttgt gagtgtggta catgtgtgta tagcatgtgt gcttgagcat gtttgtgcgt
     ataactttcc tgatccatca cactcaatcg cacactgaac ttagaactgt gctcacagcc
     tgcaaacctg agtggccctc ctgtctttta tgacacaaca ctcctgcaca acactgctga
     cacaacactg cagacacaac actgctctac gggcatgagt ggccaccttc catttttttt
     ttaagtgtgt gtgctgacgt cacaagaact caggtactct tacttcctac atggtacgag
     ttcttaccac ttagccattt cttcatcctg aaagacccca ccaagttgct tagcctgata
     gccgcagtaa cgccattttg caaggcatgg aaaaatacca aaccaagaat agggaagttc
     agatcaaggg cgggtacacg aaaacagcta acgttgggcc aaacaagata tctgcggtaa
     gcagtttcgg ccccggcccg gggccaagaa cagatggtcc ccagatatgg cccaaccctc
     agcagtttct taagacccat cagatgtttc caggctcccc caaggacctg aaatgaccct
     gtgccttatt tgaattaacc aatcagcccg cttctcgctt ctgttcgcgc gcttttgctt
     cccgagctct ataaaagagc tcacaacccc tcactcggcg cgccagtcct ccgacagact
     gagtcgcccg ggtacccgtg ttcccaataa agcctcttgc tgattgcatc cgaatcgtgg
     actcgctgat ccttgggagg gtctcctcag attgattgac tgcccacctc gggggtcttt
     catttggggg ctcgtccggg atttggagac ccccgcccag ggaccaccga cccaccgatc
     gggaggtaag cttgccagcg ggtcgactct agaggatcca gactcgagag aattcattga
     tgagtttgga caaaccacaa ctagaatgca gtgaaaaaaa tgctttattt gtgaaatttg
     tgatgctatt gctttatttg taaccattat aagctgcaat aaacaagtta acaacaacaa
     ttgcattcat tttatgtttc aggttcaggg ggaggtgtgg gaggtttttt aaagcaagta
     aaacctctac aaatgtggta tggctgatta tgatctctag tcaaggcact atacatcaaa
     tattccttat taaccccttt acaaattaaa aagctaaagg tacacaattt ttgagcatag
     ttattaatag cagacactct atgcctgtgt ggagtaagaa aaaacagtat gttatgatta
     taactgttat gcctacttat aaaggttaca gaatattttt ccataatttt cttgtatagc
     agtgcagctt tttcctttgt ggtgtaaata gcaaagcaag caagagttct attactaaac
     acagcatgac tcaaaaaact tagcaattct gaaggaaagt ccttggggtc ttctaccttt
     ctcttctttt ttggaggagt agaatgttga gagtcagcag tagcctcatc atcactagat
     ggcatttctt ctgagcaaaa caggttttcc tcattaaagg cattccacca ctgctcccat
     tcatcagttc cataggttgg aatctaaaat acacaaacaa ttagaatcag tagtttaaca
     cattatacac ttaaaaattt tatatttacc ttagagcttt aaatctctgt aggtagtttg
     tccaattatg tcacaccaca gaagtaaggt tccttcacaa agatccgggg ggtgggcgaa
     gaactccagc atgagatccc cgcgctggag gatcatccag ccggcgtccc ggaaaacgat
     tccgaagccc aacctttcat agaaggcggc ggtggaatcg aaatctcgtg atggcaggtt
     gggcgtcgct tggtcggtca tttcgaaccc cagagtcccg ctcagaagaa ctcgtcaaga
     aggcgataga aggcgatgcg ctgcgaatcg ggagcggcga taccgtaaag cacgaggaag
     cggtcagccc attcgccgcc aagctcttca gcaatatcac gggtagccaa cgctatgtcc
     tgatagcggt ccgccacacc cagccggcca cagtcgatga atccagaaaa gcggccattt
     tccaccatga tattcggcaa gcaggcatcg ccatgggtca cgacgagatc ctcgccgtcg
     ggcatgcgcg ccttgagcct ggcgaacagt tcggctggcg cgagcccctg atgctcttcg
     tccagatcat cctgatcgac aagaccggct tccatccgag tacgtgctcg ctcgatgcga
     tgtttcgctt ggtggtcgaa tgggcaggta gccggatcaa gcgtatgcag ccgccgcatt
     gcatcagcca tgatggatac tttctcggca ggagcaaggt gagatgacag gagatcctgc
     cccggcactt cgcccaatag cagccagtcc cttcccgctt cagtgacaac gtcgagcaca
     gctgcgcaag gaacgcccgt cgtggccagc cacgatagcc gcgctgcctc gtcctgcagt
     tcattcaggg caccggacag gtcggtcttg acaaaaagaa ccgggcgccc ctgcgctgac
     agccggaaca cggcggcatc agagcagccg attgtctgtt gtgcccagtc atagccgaat
     agcctctcca cccaagcggc cggagaacct gcgtgcaatc catcttgttc aatcatgcga
     aacgatcctc atcctgtctc ttgatcagat cttgatcccc tgcgccatca gatccttggc
     ggcaagaaag ccatccagtt tactttgcag ggcttcccaa ccttaccaga gggcgcccca
     gctggcaatt ccggttcgct tgctgtccat aaaaccgccc agtctagcta tcgccatgta
     agcccactgc aagctacctg ctttctcttt gcgcttgcgt tttcccttgt ccagatagcc
     cagtagctga cattcatccg gggtcagcac cgtttctgcg gactggcttt ctacgtgttc
     cgcttccttt agcagccctt gcgccctgag tgcttgcggc agcgtgacgc gttttgcaaa
     agcctagcgc tccaaaaaag cctcctcact acttctggaa tagctcagag gccgaggcgg
     cctcggcctc tgcataaata aaaaaaatta gtcagccatg gggcggagaa tgggcggaac
     tgggcggagt taggggcggg atgggcggag ttaggggcgg gactatggtt gctgactaat
     tgagatgcat gctttgcata cttctgcctg ctggggagcc tggttgctga ctaattgaga
     tgcatgcttt gcatacttct gcctgctggg gagcctgggg actttccaca ccctaactga
     cacacattcc acagctgcct cgcgcgtttc ggtgatgacg gtgaaaacct ctgacacatg
     cagctcccgg agacggtcac agcttgtctg taagcggatg ccgggagcag acaagcccgt
     cagggcgcgt cagcgggtgt tggcgggtgt cggggcgcag ccatgaccca gtcacgtagc
     gatagcggag tgtatactgg cttaactatg cggcatcaga gcagattgta ctgagagtgc
     accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgct
     cttccgcttc ctcgctcact gactcgctgc gctcggtcgt tcggctgcgg cgagcggtat
     cagctcactc aaaggcggta atacggttat ccacagaatc aggggataac gcaggaaaga
     acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt
     ttttccatag gctccgcccc cctgacgagc atcacaaaaa tcgacgctca agtcagaggt
     ggcgaaaccc gacaggacta taaagatacc aggcgtttcc ccctggaagc tccctcgtgc
     gctctcctgt tccgaccctg ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa
     gcgtggcgct ttctcatagc tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct
     ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc ttatccggta
     actatcgtct tgagtccaac ccggtaagac acgacttatc gccactggca gcagccactg
     gtaacaggat tagcagagcg aggtatgtag gcggtgctac agagttcttg aagtggtggc
     ctaactacgg ctacactaga aggacagtat ttggtatctg cgctctgctg aagccagtta
     ccttcggaaa aagagttggt agctcttgat ccggcaaaca aaccaccgct ggtagcggtg
     gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa gaagatcctt
     tgatcttttc tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg
     tcatgagatt atcaaaaagg atcttcacct agatcctttt aaattaaaaa tgaagtttta
     aatcaatcta aagtatatat gagtaaactt ggtctgacag ttaccaatgc ttaatcagtg
     aggcacctat ctcagcgatc tgtctatttc gttcatccat agttgcctga ctccccgtcg
     tgtagataac tacgatacgg gagggcttac catctggccc cagtgctgca atgataccgc
     gagacccacg ctcaccggct ccagatttat cagcaataaa ccagccagcc ggaagggccg
     agcgcagaag tggtcctgca actttatccg cctccatcca gtctattaat tgttgccggg
     aagctagagt aagtagttcg ccagttaata gtttgcgcaa cgttgttgcc attgctgcag
     gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt cagctccggt tcccaacgat
     caaggcgagt tacatgatcc cccatgttgt gcaaaaaagc ggttagctcc ttcggtcctc
     cgatcgttgt cagaagtaag ttggccgcag tgttatcact catggttatg gcagcactgc
     ataattctct tactgtcatg ccatccgtaa gatgcttttc tgtgactggt gagtactcaa
     ccaagtcatt ctgagaatag tgtatgcggc gaccgagttg ctcttgcccg gcgtcaacac
     gggataatac cgcgccacat agcagaactt taaaagtgct catcattgga aaacgttctt
     cggggcgaaa actctcaagg atcttaccgc tgttgagatc cagttcgatg taacccactc
     gtgcacccaa ctgatcttca gcatctttta ctttcaccag cgtttctggg tgagcaaaaa
     caggaaggca aaatgccgca aaaaagggaa taagggcgac acggaaatgt tgaatactca
     tactcttcct ttttcaatat tattgaagca tttatcaggg ttattgtctc atgagcggat
     acatatttga atgtatttag aaaaataaac aaataggggt tccgcgcaca tttccccgaa
     aagtgccacc tgacgtctaa gaaaccatta ttatcatgac attaacctat aaaaataggc
     gtatcacgag gccctttcgt
//