back Return to this vector's summary.
ID   PMMB66HE   preliminary; circular DNA; SYN; 8821 BP.
XX
AC   M28829; L23118; ATCC37621;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Broad host range/E.coli plasmid vector pMMB66HE - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pJF118EH, pJF118HE from pMMB22 & pKK223-3
RC   pMMB66EH from RSF1010 & pJF118EH
RC   pMMB66HE from pMMB66EH & pJF118HE
RC   pJF119EH from pJF118EH & M13mp18
RC   pJF119HE from pJF118HE & M13mp18
RC   pMMB67EH from pMMB66EH & M13mp18
RC   pMMB67HE from pMMB66HE & M13mp18
RC   pMS324a from R300B & RP4
RC   pFG101 series from pJF118EH & pMS324a
RC   pFG102 series from pJF118HE & pMS324a
RC   pWP101 series from pMMB66EH & pMS324a
RC   pWP102 series from pMMB66HE & pMS324a
RA   Furste J.P., Pansegrau W., Frank R., Blocker H., Scholz P.,
RA   Bagdasarian M., Lanka E.;
RT   "Molecular cloning of the plasmid RP4 primase region in a
RT   multi-host-range tacP expression vector";
RL   Gene 48:119-131(1986).
XX
RN   [2]
RC   pMG from pMMB66HE & pCH58, phoA gene
RA   Blanco D.R., Giladi M., Champion C.I., Haake D.A., Chikami G.K.,
RA   Miller J.N., Lovett M.A.;
RT   "Identification of Treponema pallidum subspecies pallidum genes
RT   encoding signal peptides and membrane-spanning sequences using a
RT   novel alkaline phosphatase expression vector";
RL   Mol. Microbiol. 5:2405-2415(1991).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   Restriction digests of the clone give the following sizes (kb):
CC   AccI--3.8, 3.1, 1.9; BamHI--8.6; HindIII/PvuII--7.4, 1.3. (ATCC staff)
CC   Contains the following sites separated by (bp): EcoRI - 739 - AhaIII -
CC   97 - ScaI - 112 - PvuI - 2101 - AccI - 1848 - ScaI - 55 - AccI - 2039
CC   - BstEII - 372 - PvuII - 93 - PvuII - 94 - HpaI - 320 - BstEII - 182
CC   - MluI - 771 - EcoRI. (personal communication)
CC   The sequence of RSF1010 is given in this reference. [2]
CC   A 1246 bp lacIQ HindIII fragment inserted at XmaIII/BamHI of pKK223-3.
CC   A M13mp9 polylinker replaced the M13mp8 polylinker of pMMB66EH
CC   (ATCC 37620).
CC   THe 3005 bp NruI/AhaIII fragment was cloned between PstI (7768) and
CC   PvuII (1951) of RSF1010. [1]
CC   In the pMMB66 (ATCC 37620, 37621) and pMMB67 (ATCC 37622, 37623)
CC   vector series, the EH and HE in the name designate the orientation of
CC   the multiple cloning site to the tac promoter. (personal
CC   communication)
CC   An autoregulated high-level expression vector utilizing the tac
CC   promoter, rrnB terminators and lacIq for lac repression. Concentration
CC   of induced gene product may be regulated by varying the lac inducer
CC   concentration. [1]
CC   Can be mobilized by conjugative IncP helper plasmids [e.g. pRK2013
CC   (ATCC 37159), pUB307] into Klebsiella aerogenes, Proteus mirabilis,
CC   Pseudomonas aeruginosa, Serratia marcescens, and other gram-negative
CC   bacteria. [1]
CC   Medium is 1227 LB plus ampicillin.
CC   NM (pMMB66HE)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (ATCC)
CC   HO (E.coli HB101)(broad host range)(E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pMMB66EH)(pJF118HE)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pMMB22 remove, 12700bp-
FT                   2. pKK223-3 4584bp
FT                   -> pJF118EH
FT                   1. pJF118EH remove EcoRI-HindIII, MCS
FT                   fill in:fill in
FT                   2. oligo HindIII-PstI-SalI-BamHI-SmaI-EcoRI 40bp
FT                   \ aattaagcttggctgcaggtcgacggatccccgggaattc
FT                   -> pJF118HE
FT                   1. pMMB66EH remove MluI-PvuI 1704bp 8074..8807..971,
FT                   \ 7103bp
FT                   2. pJF118HE MluI-PvuI 1719bp
FT                   \ pKK223-3 MluI 3617
FT                   -> pMMB66HE 8820bp"
FT   -               1..40
FT                   /note="aattaagcttggctgcaggtcgacggatccccgggaattc 40bp
FT                   \ ...gaattc
FT                   HindIII = A^AGCTT"
FT   -               41..8821
FT                   /note="pMMB66EH 29..8807..2 8781bp
FT                   EcoRI = G^AATT C
FT                   \              aatta..."
FT   misc_binding    0..0
FT                   /note="MCS HindIII-PstI-SalI-BamHI-SmaI-EcoRI"
FT   misc_binding    0..0
FT                   /note="SIT unique HindIII-PstI-SalI-BamHI-SmaI-EcoRI"
FT   rep_origin      0..0
FT                   /note="ORI E. coli IncQ plasmid RSF1010 oriT and oriV"
FT   promoter        0..0
FT                   /note="PRO E. coli tac"
FT   CDS             0..0
FT                   /note="REP E. coli lacIq repressor gene"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
XX
SQ   Sequence 8821 BP; 1909 A; 2576 C; 2635 G; 1701 T; 0 other;
     aattaagctt ggctgcaggt cgacggatcc ccgggaattc agcttggctg ttttggcgga
     tgagagaaga ttttcagcct gatacagatt aaatcagaac gcagaagcgg tctgataaaa
     cagaatttgc ctggcggcag tagcgcggtg gtcccacctg accccatgcc gaactcagaa
     gtgaaacgcc gtagcgccga tggtagtgtg gggtctcccc atgcgagagt agggaactgc
     caggcatcaa ataaaacgaa aggctcagtc gaaagactgg gcctttcgtt ttatctgttg
     tttgtcggtg aacgctctcc tgagtaggac aaatccgccg ggagcggatt tgaacgttgc
     gaagcaacgg cccggagggt ggcgggcagg acgcccgcca taaactgcca ggcatcaaat
     taagcagaag gccatcctga cggatggcct ttttgcgttt ctacaaactc ttttgtttat
     ttttctaaat acattcaaat atgtatccgc tcatgagaca ataaccctga taaatgcttc
     aataatattg aaaaaggaag agtatgagta ttcaacattt ccgtgtcgcc cttattccct
     tttttgcggc attttgcctt cctgtttttg ctcacccaga aacgctggtg aaagtaaaag
     atgctgaaga tcagttgggt gcacgagtgg gttacatcga actggatctc aacagcggta
     agatccttga gagttttcgc cccgaagaac gttttccaat gatgagcact tttaaagttc
     tgctatgtgg cgcggtatta tcccgtgttg acgccgggca agagcaactc ggtcgccgca
     tacactattc tcagaatgac ttggttgagt actcaccagt cacagaaaag catcttacgg
     atggcatgac agtaagagaa ttatgcagtg ctgccataac catgagtgat aacactgcgg
     ccaacttact tctgacaacg atcggaggac cgaaggagct aaccgctttt ttgcacaaca
     tgggggatca tgtaactcgc cttgatcgtt gggaaccgga gctgaatgaa gccataccaa
     acgacgagcg tgacaccacg atgcctgtag caatggcaac aacgttgcgc aaactattaa
     ctggcgaact acttactcta gcttcccggc aacaattaat agactggatg gaggcggata
     aagttgcagg accacttctg cgctcggccc ttccggctgg ctggtttatt gctgataaat
     ctggagccgg tgagcgtggg tctcgcggta tcattgcagc actggggcca gatggtaagc
     cctcccgtat cgtagttatc tacacgacgg ggagtcaggc aactatggat gaacgaaata
     gacagatcgc tgagataggt gcctcactga ttaagcattg gtaactgtca gaccaagttt
     actcatatat actttagatt gatttctgaa agcgaccagg tgctcggcgt ggcaagactc
     gcagcgaacc cgtagaaagc catgctccag ccgcccgcat tggagaaatt cttcaaattc
     ccgttgcaca tagcccggca attcctttcc ctgctctgcc ataagcgcag cgaatgccgg
     gtaatactcg tcaacgatct gatagagaag ggtttgctcg ggtcggtggc tctggtaacg
     accagtatcc cgatcccggc tggccgtcct ggccgccaca tgaggcatgt tccgcgtcct
     tgcaatactg tgtttacata cagtctatcg cttagcggaa agttctttta ccctcagccg
     aaatgcctgc cgttgctaga cattgccagc cagtgcccgt cactcccgta ctaactgtca
     cgaacccctg caataactgt cacgcccccc tgcaataact gtcacgaacc cctgcaataa
     ctgtcacgcc cccaaacctg caaacccagc aggggcgggg gctggcgggg tgttggaaaa
     atccatccat gattatctaa gaataatcca ctaggcgcgg ttatcagcgc ccttgtgggg
     cgctgctgcc cttgcccaat atgcccggcc agaggccgga tagctggtct attcgctgcg
     ctaggctaca caccgcccca ccgctgcgcg gcagggggaa aggcgggcaa agcccgctaa
     accccacacc aaaccccgca gaaatacgct ggagcgcttt tagccgcttt agcggccttt
     ccccctaccc gaagggtggg ggcgcgtgtg cagccccgca gggcctgtct cggtcgatca
     ttcagcccgg ctcatccttc tggcgtggcg gcagaccgaa caaggcgcgg tcgtggtcgc
     gttcaaggta cgcatccatt gccgccatga gccgatcctc cggccactcg ctgctgttca
     ccttggccaa aatcatggcc cccaccagca ccttgcgcct tgtttcgttc ttgcgctctt
     gctgctgttc ccttgcccgc tcccgctgaa tttcggcatt gattcgcgct cgttgttctt
     cgagcttggc cagccgatcc gccgccttgt tgctcccctt aaccatcttg acaccccatt
     gttaatgtgc tgtctcgtag gctatcatgg aggcacagcg gcggcaatcc cgaccctact
     ttgtagggga gggcgcactt accggtttct cttcgagaaa ctggcctaac ggccaccctt
     cgggcggtgc gctctccgag ggccattgca tggagccgaa aagcaaaagc aacagcgagg
     cagcatggcg atttatcacc ttacggcgaa aaccggcagc aggtcgggcg gccaatcggc
     cagggccaag gccgactaca tccagcgcga aggcaagtat gcccgcgaca tggatgaagt
     cttgcacgcc gaatccgggc acatgccgga gttcgtcgag cggcccgccg actactggga
     tgctgccgac ctgtatgaac gcgccaatgg gcggctgttc aaggaggtcg aatttgccct
     gccggtcgag ctgaccctcg accagcagaa ggcgctggcg tccgagttcg cccagcacct
     gaccggtgcc gagcgcctgc cgtatacgct ggccatccat gccggtggcg gcgagaaccc
     gcactgccac ctgatgatct ccgagcggat caatgacggc atcgagcggc ccgccgctca
     gtggttcaag cggtacaacg gcaagacccc ggagaagggc ggggcacaga agaccgaagc
     gctcaagccc aaggcatggc ttgagcagac ccgcgaggca tgggccgacc atgccaaccg
     ggcattagag cgggctggcc acgacgcccg cattgaccac agaacacttg aggcgcaggg
     catcgagcgc ctgcccggtg ttcacctggg gccgaacgtg gtggagatgg aaggccgggg
     catccgcacc gaccgggcag acgtggccct gaacatcgac accgccaacg cccagatcat
     cgacttacag gaataccggg aggcaataga ccatgaacgc aatcgacaga gtgaagaaat
     ccagaggcat caacgagtta gcggagcaga tcgaaccgct ggcccagagc atggcgacac
     tggccgacga agcccggcag gtcatgagcc agaccaagca ggccagcgag gcgcaggcgg
     cggagtggct gaaagcccag cgccagacag gggcggcatg ggtggagctg gccaaagagt
     tgcgggaggt agccgccgag gtgagcagcg ccgcgcagag cgcccggagc gcgtcgcggg
     ggtggcactg gaagctatgg ctaaccgtga tgctggcttc catgatgcct acggtggtgc
     tgctgatcgc atcgttgctc ttgctcgacc tgacgccact gacaaccgag gacggctcga
     tctggctgcg cttggtggcc cgatgaagaa cgacaggact ttgcaggcca taggccgaca
     gctcaaggcc atgggctgtg agcgcttcga tatcggcgtc agggacgcac ccaccggcca
     gatgatgaac cgggaatggt cagccgccga agtgctccag aacacgccat ggctcaagcg
     gatgaatgcc cagggcaatg acgtgtatat caggcccgcc gagcaggagc ggcatggtct
     ggtgctggtg gacgacctca gcgagtttga cctggatgac atgaaagccg agggccggga
     gcctgccctg gtagtggaaa ccagcccgaa gaactatcag gcatgggtca aggtggccga
     cgccgcaggc ggtgaacttc gggggcagat tgcccggacg ctggccagcg agtacgacgc
     cgacccggcc agcgccgaca gccgccacta tggccgcttg gcgggcttca ccaaccgcaa
     ggacaagcac accacccgcg ccggttatca gccgtgggtg ctgctgcgtg aatccaaggg
     caagaccgcc accgctggcc cggcgctggt gcagcaggct ggccagcaga tcgagcaggc
     ccagcggcag caggagaagg cccgcaggct ggccagcctc gaactgcccg agcggcagct
     tagccgccac cggcgcacgg cgctggacga gtaccgcagc gagatggccg ggctggtcaa
     gcgcttcggt catgacctca gcaagtgcga ctttatcgcc gcgcagaagc tggccagccg
     gggccgcagt gccgaggaaa tcggcaaggc catggccgag gccagcccag cgctggcaga
     gcgcaagccc ggccacgaag cggattacat cgagcgcacc gtcagcaagg tcatgggtct
     gcccagcgtc cagcttgcgc gggccgagct ggcacgggca ccggcacccc gccagcgagg
     catggacagg ggcgggccag atttcagcat gtagtgcttg cgttggtact cacgcctgtt
     atactatgag tactcacgca cagaaggggg ttttatggaa tacgaaaaaa gcgcttcagg
     gtcggtctac ctgatcaaaa gtgacaaggg ctattggttg cccggtggct ttggttatac
     gtcaaacaag gccgaggctg gccgcttttc agtcgctgat atggccagcc ttaaccttga
     cggctgcacc ttgtccttgt tccgcgaaga caagcctttc ggccccggca agtttctcgg
     tgactgatat gaaagaccaa aaggacaagc agaccggcga cctgctggcc agccctgacg
     ctgtacgcca agcgcgatat gccgagcgca tgaaggccaa agggatgcgt cagcgcaagt
     tctggctgac cgacgacgaa tacgaggcgc tgcgcgagtg cctggaagaa ctcagagcgg
     cgcagggcgg gggtagtgac cccgccagcg cctaaccacc aactgcctgc aaaggaggca
     atcaatggct acccataagc ctatcaatat tctggaggcg ttcgcagcag cgccgccacc
     gctggactac gttttgccca acatggtggc cggtacggtc ggggcgctgg tgtcgcccgg
     tggtgccggt aaatccatgc tggccctgca actggccgca cagattgcag gcgggccgga
     tctgctggag gtgggcgaac tgcccaccgg cccggtgatc tacctgcccg ccgaagaccc
     gcccaccgcc attcatcacc gcctgcacgc ccttggggcg cacctcagcg ccgaggaacg
     gcaagccgtg gctgacggcc tgctgatcca gccgctgatc ggcagcctgc ccaacatcat
     ggccccggag tggttcgacg gcctcaagcg cgccgccgag ggccgccgcc tgatggtgct
     ggacacgctg cgccggttcc acatcgagga agaaaacgcc agcggcccca tggcccaggt
     catcggtcgc atggaggcca tcgccgccga taccgggtgc tctatcgtgt tcctgcacca
     tgccagcaag ggcgcggcca tgatgggcgc aggcgaccag cagcaggcca gccggggcag
     ctcggtactg gtcgataaca tccgctggca gtcctacctg tcgagcatga ccagcgccga
     ggccgaggaa tggggtgtgg acgacgacca gcgccggttc ttcgtccgct tcggtgtgag
     caaggccaac tatggcgcac cgttcgctga tcggtggttc aggcggcatg acggcggggt
     gctcaagccc gccgtgctgg agaggcagcg caagagcaag ggggtgcccc gtggtgaagc
     ctaagaacaa gcacagcctc agccacgtcc ggcacgaccc ggcgcactgt ctggcccccg
     gcctgttccg tgccctcaag cggggcgagc gcaagcgcag caagctggac gtgacgtatg
     actacggcga cggcaagcgg atcgagttca gcggcccgga gccgctgggc gctgatgatc
     tgcgcatcct gcaagggctg gtggccatgg ctgggcctaa tggcctagtg cttggcccgg
     aacccaagac cgaaggcgga cggcagctcc ggctgttcct ggaacccaag tgggaggccg
     tcaccgctga atgccatgtg gtcaaaggta gctatcgggc gctggcaaag gaaatcgggg
     cagaggtcga tagtggtggg gcgctcaagc acatacagga ctgcatcgag cgcctttgga
     aggtatccat catcgcccag aatggccgca agcggcaggg gtttcggctg ctgtcggagt
     acgccagcga cgaggcggac gggcgcctgt acgtggccct gaaccccttg atcgcgcagg
     ccgtcatggg tggcggccag catgtgcgca tcagcatgga cgaggtgcgg gcgctggaca
     gcgaaaccgc ccgcctgctg caccagcggc tgtgtggctg gatcgacccc ggcaaaaccg
     gcaaggcttc catagatacc ttgtgcggct atgtctggcc gtcagaggcc agtggttcga
     ccatgcgcaa gcgccgcaag cgggtgcgcg aggcgttgcc ggagctggtc gcgctgggct
     ggacggtaac cgagttcgcg gcgggcaagt acgacatcac ccggcccaag gcggcaggct
     gacccccccc actctattgt aaacaagaca tttttatctt ttatattcaa tggcttattt
     tcctgctaat tggtaatacc atgaaaaata ccatgctcag aaaaggctta acaatatttt
     gaaaaattgc ctactgagcg ctgccgcaca gctccatagg ccgctttcct ggctttgctt
     ccagatgtat gctcttctgc tcccgaacgc cagcaagacg tagcccagcg cgtcggccag
     cttgcaattc gcgctaactt acattaattg cgttgcgctc actgcccgct ttccagtcgg
     gaaacctgtc gtgccagctg cattaatgaa tcggccaacg cgcggggaga ggcggtttgc
     gtattgggcg ccagggtggt ttttcttttc accagtgaga cgggcaacag ctgattgccc
     ttcaccgcct ggccctgaga gagttgcagc aagcggtcca cgtggtttgc cccagcaggc
     gaaaatcctg tttgatggtg gttaacggcg ggatataaca tgagctgtct tcggtatcgt
     cgtatcccac taccgagata tccgcaccaa cgcgcagccc ggactcggta atggcgcgca
     ttgcgcccag cgccatctga tcgttggcaa ccagcatcgc agtgggaacg atgccctcat
     tcagcatttg catggtttgt tgaaaaccgg acatggcact ccagtcgcct tcccgttccg
     ctatcggctg aatttgattg cgagtgagat atttatgcca gccagccaga cgcagacgcg
     ccgagacaga acttaatggg cccgctaaca gcgcgatttg ctggtgaccc aatgcgacca
     gatgctccac gcccagtcgc gtaccgtctt catgggagaa aataatactg ttgatgggtg
     tctggtcaga gacatcaaga aataacgccg gaacattagt gcaggcagct tccacagcaa
     tggcatcctg gtcatccagc ggatagttaa tgatcagccc actgacgcgt tgcgcgagaa
     gattgtgcac cgccgcttta caggcttcga cgccgcttcg ttctaccatc gacaccacca
     cgctggcacc cagttgatcg gcgcgagatt taatcgccgc gacaatttgc gacggcgcgt
     gcagggccag actggaggtg gcaacgccaa tcagcaacga ctgtttgccc gccagttgtt
     gtgccacgcg gttgggaatg taattcagct ccgccatcgc cgcttccact ttttcccgcg
     ttttcgcaga aacgtggctg gcctggttca ccacgcggga aacggtctga taagagacac
     cggcatactc tgcgacatcg tataacgtta ctggtttcac attcaccacc ctgaattgac
     tctcttccgg gcgctatcat gccataccgc gaaaggtttt gcaccattcg atggtgtcaa
     cgtaaatgcc gcttcgcctt cgcgcgcgaa ttgcaagctg atccgggctt atcgactgca
     cggtgcacca atgcttctgg cgtcaggcag ccatcggaag ctgtggtatg gctgtgcagg
     tcgtaaatca ctgcataatt cgtgtcgctc aaggcgcact cccgttctgg ataatgtttt
     ttgcgccgac atcataacgg ttctggcaaa tattctgaaa tgagctgttg acaattaatc
     atcggctcgt ataatgtgtg gaattgtgag cggataacaa tttcacacag gaaacagaat
     t
//