back Return to this vector's summary.
ID   PNIMB      preliminary; circular DNA; SYN; 2715 BP.
XX
AC   IG5136;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pNIMB - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pNIMB from pUR222 & linker
RA   Kravchenko V.V., Serpinsky O.I., Sivolobova G., Schubina T.N.;
RT   "[Plasmid vector for cloning, determination of nucleotide sequence
RT   and directed assembly of DNA fragments]";
RL   Mol. Biol. 21:194-199(1987).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   MCS. oligonucleotide linker.
CC   NM (pNIMB)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pUR222)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pUR222 remove EcoRI-PstI 25bp 1830..1855,
FT                   \ 2675bp
FT                   2. linker PstI-HgaI-AccI-SalI-HindII-HindIII-BamHI-
FT                   \ HgaI-EcoRI 40bp
FT                   \ gggacgcgtcgacaagcttggatccgcgtctg
FT                   \ 3'acgtccctgcgcagctgttcgaacctaggcgcagacttaa5'
FT                   -> pNIMB 2715bp"
FT   -               1..1829
FT                   /note="pUR222 1..1829 1829bp
FT                   EcoRI = G^AATTC
FT                   \         aattc..."
FT   -               1830..1869
FT                   /note="aattcagacgcggatccaagcttgtcgacgcgtccctgca 40bp
FT                   \  ...cctgca
FT                   PstI = CTGCA^G"
FT   -               1870..2715
FT                   /note="pUR222 1855..2700 846bp"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 2715 BP; 660 A; 670 C; 704 G; 681 T; 0 other;
     tcgaactgga tctcaacagc ggtaagatcc ttgagagttt tcgccccgaa gaacgttttc
     caatgatgag cacttttaaa gttctgctat gtggcgcggt attatcccgt gttgatgccg
     ggcaagagca actcggtcgc gcgatacact attctcagaa tgacttggtt gagtactcac
     cagtcacaga aaagcatctt acggatggca tgacagtaag agaattatgc agtgctgcca
     taaccatgag tgataacact gcggccaact tacttctgac aacgatcgga ggaccgaagg
     agctaaccgc ttttttgcac aacatggggg atcatgtaac tcgccttgat cgttgggaac
     cggagctgaa tgaagccata ccaaacgacg agcgtgacac cacgatgcct gtagcaatgg
     caacaacgtt gcgcaaacta ttaactggcg aactacttac tctagcttcc cggcaacaat
     taatagactg gatggaggcg gataaagttg caggaccact tctgcgctcg gcccttccgg
     ctggctggtt tattgctgat aaatctggag ccggtgagcg tgggtctcgc ggtatcattg
     cagcactggg gccagatggt aagccctccc gtatcgtagt tatctacacg acggggagtc
     aggcaactat ggatgaacga aatagacaga tcgctgagat aggtgcctca ctgattaagc
     attggtaact gtcagaccaa gtttactcat atatacttta gattgattta aaacttcatt
     tttaatttaa aaggatctag gtgaagatcc tttttgataa tctcatgacc aaaatcccta
     acgtgagttt tcgttccact gagcgtcaga ccccgtagaa aagatcaaag gatcttcttg
     agatcctttt tttctgcgcg taatctgctg cttgcaaaca aaaaaaccac cgctaccagc
     ggtggtttgt ttgccggatc aagagctacc aactcttttt ccgaaggtaa ctggcttcag
     cagagcgcag ataccaaata ctgtccttct agtgtagccg tagttaggcc accacttcaa
     gaactctgta gcaccgccta catacctcgt cctgctaatc ctgttaccag tggctgctgc
     cagtggcgat aagtcgtgtc ttaccgggtt ggactcaaga cgatagttac cggataaggc
     gcagcggtcg ggctgaacgg ggggttcgtg cacacagccc agcttggagc gaacgaccta
     caccgaactg agatacctac agcgtgagct atgagaaagc gccacgcttc ccgaagggag
     aaaggcggac aggtatccgg taagcggcag ggtcggaaca ggagagcgca cgagggagct
     tccaggggga aacgcctggt atctttatag tcctgtcggg tttcgccacc tctgacttga
     gcgtcgattt ttgtgatgct cgtcaggggg gcggagccta tggaaaaacg ccagcaacgc
     ggccttttta cggttcctgg ccttttgctg gccttttgct cacatgttct ttcctgcgtt
     atcccctgat tctgtggata accgtattac cgcctttgag tgagctgata ccgctcgccg
     cagccgaacg accgagcgca gcgagtcagt gagcgaggaa gcggaagagc gccattcgcc
     attcaggcta cgcaactgtt gggaagggcg atcggtgcgg gcctcttcgc tattacgcca
     gctggcgaag gggggatgtg ctgcaaggcg attaagttgg gtaacgccag ggttttccca
     gtcacgacgt tgtaaaacga cggccagtga attcagacgc ggatccaagc ttgtcgacgc
     gtccctgcag caattcgtaa tcatggtcat agctgtttcc tgtgtgaaat tgttatccgc
     tcacaattcc acacaacata cgagccggaa gcataaagtg taaagcctgg ggtgcctaat
     gagtgagcta agtcacatta attgcgttgc gctcactgcc cgctttccag tcgggaaacc
     tgtcgtgcca gctggattaa tgaatcggcc aacgcgccgg gagaggcggt ttgcgtattg
     ggcgcctgat gcggtatttt ctccttacgc atctgtgcgg tatttcacac cgcatatggt
     gcactctcag tacaatctgc tctgatgccg catagttaag ccagtaatac actccgctat
     cgctacgtga ctgggtcatg gctgcgcccc gacacccgcc aacacccgct gacgcgccct
     gatgggcttg tctgctcccg gcatccgctt acagacaagc tgtgaccgtc tccgggagct
     gcatgtgtca gaggttttca ccgtcatcac cgaaacgcgc gagacgaaag ggcctcgtga
     tacgcctatt tttataggtt aatgtcatga taataatggt ttcttagacg tcaggtggca
     cttttcgggg aaatgtgcgc ggaaccccta tttgtttatt tttctaaata cattcaaata
     tgtatccgct catgagacaa taaccctgat aaatgcttca ataatattga aaaaggaaga
     gtatgagtat tcaacatttc cgtgtcgccc ttattccctt ttttgcggca ttttgccttc
     ctgtttttgc tcacccagaa acgctggtga aagtaaaaga tgctgaagat cagttgggtg
     cacgagtggg ttaca
//