back Return to this vector's summary.
ID   PNOM102    preliminary; circular DNA; SYN; 7599 BP.
XX
AC   Z32701;
XX
DT   01-JUL-1994 (Rel. 9, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pNOM102 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-7599
RC   pJI1139 from beta-glucuronidase gene
RC   pGSN1 from pJI1139 & linker
RC   pNOM102 from pGSN1 & pAN52-1
RA   Roberts I.A., Oliver R.P., Punt P.J., Van Den Hondel C.A.M.J.J.;
RT   "Expression of the Escherichia coli beta-glucuronidase gene in
RT   industrial and phytopathogenic filamentous fungi";
RL   Curr. Genet. 15:177-180(1989).
XX
RN   [2]
RP   1-7599
RC   pNOM102
RA   Punt P.;
RT   ;
RL   Submitted (22-APR-1994) to the EMBL/GenBank/DDBJ databases by:
RL   Punt P., TNO Nutrition and Food Research Institute, Lange Kleiweg 139,
RL   Rijkswik, The Netherlands.
XX
RN   [3]
RC   pJI1139 from pRAJ275
RA   Wilson T.M.A.;
RT   ;
RL   Unpublished (1989).
XX
CC   NCBI gi: 475168
CC   NM (pNOM102)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA ()
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pRAJ275 4519bp, uidA gene
FT                   -> pJI1139 4519bp
FT                   1. pJI1139 HindIII 2..2, uidA gene 5'
FT                   fill in
FT                   NcoI linker 8bp gccatggc
FT                   HindIII ?..?, uidA gene 3'
FT                   fill in
FT                   NcoI linker 8bp gccatggc
FT                   -> pGSN1 4519bp
FT                   1. pGSN1 NcoI-NcoI 1900bp, uidA gene
FT                   2. pAN52-1 NcoI 5721bp 2301..2301,
FT                   \ between gpd gene and trpC terminator
FT                   -> pNOM102 7599bp"
FT   promoter        1..2129
FT                   /note="PRO A.nidulans gpdA gene;
FT                   EXPERIMENTAL [1] [2]"
FT   misc_feature    2130..2130
FT                   /note="A.nidulans gpdA gene major
FT                   transcription start site; EXPERIMENTAL [1]"
FT   intron          2178..2293
FT                   /note="EXPERIMENTAL [1]"
FT   mutation        2302..2307
FT                   /note="replace(2302..2307,atggtc);
FT                   the region around the atg was mutated to generate A
FT                   NcoI site (information from Clontech Inc.) verified by
FT                   sequence analysis [2]"
FT   mutation        2808..2808
FT                   /note="replace(2808,a);
FT                   mutation to remove the BAMHI site in the wildtype
FT                   uidA gene [2]"
FT   misc_difference 3136..3136
FT                   /note="replace(3136,g);
FT                   copy mistake in the genbank entry; see: Jefferson et
FT                   al., PNAS 83:8447-8451(1986) [2]"
FT   misc_difference 3560..3579
FT                   /note="replace(3560..3579,gtgcacgggaatatttcgcg);
FT                   sequence corrections as in Farrell and Beachy:
FT                   Plant Mol. Biol. 15:821-825(1990) [2]"
FT   CDS             2302..4113
FT                   /note="beta-glucuronidase gene uidA GUS;
FT                   EXPERIMENTAL [2]"
FT   terminator      4182..4951
FT                   /note="TER A. nidulans trpC gene terminator region
FT                   (containing CDS); EXPERIMENTAL [2],[3];
FT                   contains the 3'end of the trpC
FT                   transcript including 50 codons; two major
FT                   transcription ends have been identified"
FT   misc_difference 4443..4453
FT                   /note="replace(4443..4453,gccttncaggc);
FT                   introduction of one base at this position generates
FT                   an BlgI site which was shown to be present by
FT                   restriction digestion [3]"
FT   misc_difference 4652..4660
FT                   /note="replace(4652..4660,cagcncctg);
FT                   introduction of one base at this position generates
FT                   an AlwNI site which was shown to be present by
FT                   restriction digestion [3]"
FT   misc_difference 4740..4750
FT                   /note="replace(4740..4750,gaaatcanttc);
FT                   introduction (actual sequence could be deletion as
FT                   well) of a base at this position results in the
FT                   elimination of an XmnI site which was shown to be
FT                   absent by restriction digestion [3]"
FT   mutation        4777..4784
FT                   /note="replace(4777..4784,catgcatg);
FT                   A NcoI site present at this position was removed by
FT                   digestion, treatment with klenow polymerase and
FT                   religation [2]"
FT   polyA_site      4433..4443
FT                   /note="partial"
FT   polyA_site      4706..4716
FT                   /note="partial"
FT   misc_feature    4952..7599
FT                   /note="from pUC18 SalI-EcoRI [2]"
FT   misc_feature    1..7599
FT                   /note="fungal B-glucuronidase expression vector
FT                   pNOM102; EXPERIMENTAL [2]"
XX
SQ   Sequence 7599 BP; 1915 A; 1908 C; 1902 G; 1871 T; 3 other;
     gaattccctt gtatctctac acacaggctc aaatcaataa gaagaacggt tcgtcttttt
     cgtttatatc ttgcatcgtc ccaaagctat tggcgggata ttctgtttgc agttggctga
     cttgaagtaa tctctgcaga tctttcgaca ctgaaatacg tcgagcctgc tccgcttgga
     agcggcgagg agcctcgtcc tgtcacaact accaacatgg agtacgataa gggccagttc
     cgccagctca ttaagagcca gttcatgggc gttggcatga tggccgtcat gcatctgtac
     ttcaagtaca ccaacgctct tctgatccag tcgatcatcc gctgaaggcg ctttcgaatc
     tggttaagat ccacgtcttc gggaagccag cgactggtga cctccagcgt ccctttaagg
     ctgccaacag ctttctcagc cagggccagc ccaagaccga caaggcctcc ctccagaacg
     ccgagaagaa ctggaggggt ggtgtcaagg aggagtaagc tccttattga agtcggagga
     cggagcggtg tcaagaggat attcttcgac tctgtattat agataagatg atgaggaatt
     ggaggtagca tagcttcatt tggatttgct ttccaggctg agactctagc ttggagcata
     gagggtcctt tggctttcaa tattctcaag tatctcgagt ttgaacttat tccctgtgaa
     ccttttattc accaatgagc attggaatga acatgaatct gaggactgca atcgccatga
     ggttttcgaa atacatccgg atgtcgaagg cttggggcac ctgcgttggt tgaatttaga
     acgtggcact attgatcatc cgatagctct gcaaagggcg ttgcacaatg caagtcaaac
     gttgctagca gttccaggtg gaatgttatg atgagcattg tattaaatca ggagatatag
     catgatctct agttagctca ccacaaaagt cagacggcgt aaccaaaagt cacacaacac
     aagctgtaag gatttcggca cggctacgga agacggagaa gccaccttca gtggactcga
     gtaccattta attctatttg tgtttgatcg agacctaata cagcccctac aacgaccatc
     aaagtcgtat agctaccagt gaggaagtgg actcaaatcg acttcagcaa catctcctgg
     ataaacttta agcctaaact atacagaata agataggtgg agagcttata ccgagctccc
     aaatctgtcc agatcatggt tgaccggtgc ctggatcttc ctatagaatc atccttattc
     gttgacctag ctgattctgg agtgacccag agggtcatga cttgagccta aaatccgccg
     cctccaccat ttgtagaaaa atgtgacgaa ctcgtgagct ctgtacagtg accggtgact
     ctttctggca tgcggagaga cggacggacg cagagagaag ggctgagtaa taagccactg
     gccagacagc tctggcggct ctgaggtgca gtggatgatt attaatccgg gaccggccgc
     ccctccgccc cgaagtggaa aggctggtgt gcccctcgtt gaccaagaat ctattgcatc
     atcggagaat atggagcttc atcgaatcac cggcagtaag cgaaggagaa tgtgaagcca
     ggggtgtata gccgtcggcg aaatagcatg ccattaacct aggtacagaa gtccaattgc
     ttccgatctg gtaaaagatt cacgagatag taccttctcc gaagtaggta gagcgagtac
     ccggcgcgta agctccctaa ttggcccatc cggcatctgt agggcgtcca aatatcgtgc
     ctctcctgct ttgcccggtg tatgaaaccg gaaaggccgc tcaggagctg gccagcggcg
     cagaccggga acacaagctg gcagtcgacc catccggtgc tctgcactcg acctgctgag
     gtccctcagt ccctggtagg cagctttgcc ccgtctgtcc gcccggtgtg tcggcggggt
     tgacaaggtc gttgcgtcag tccaacattt gttgccatat tttcctgctc tccccaccag
     ctgctctttt cttttctctt tcttttccca tcttcagtat attcatcttc ccatccaaga
     acctttattt cccctaagta agtactttgc tacatccata ctccatcctt cccatccctt
     attcctttga acctttcagt tcgagctttc ccacttcatc gcagcttgac taacagctac
     cccgcttgag cagacatcac catggtccgt cctgtagaaa ccccaacccg tgaaatcaaa
     aaactcgacg gcctgtgggc attcagtctg gatcgcgaaa actgtggaat tgatcagcgt
     tggtgggaaa gcgcgttaca agaaagccgg gcaattgctg tgccaggcag ttttaacgat
     cagttcgccg atgcagatat tcgtaattat gcgggcaacg tctggtatca gcgcgaagtc
     tttataccga aaggttgggc aggccagcgt atcgtgctgc gtttcgatgc ggtcactcat
     tacggcaaag tgtgggtcaa taatcaggaa gtgatggagc atcagggcgg ctatacgcca
     tttgaagccg atgtcacgcc gtatgttatt gccgggaaaa gtgtacgtat caccgtttgt
     gtgaacaacg aactgaactg gcagactatc ccgccgggaa tggtgattac cgacgaaaac
     ggcaagaaaa agcagtctta cttccatgat ttctttaact atgccggaat ccatcgcagc
     gtaatgctct acaccacgcc gaacacctgg gtggacgata tcaccgtggt gacgcatgtc
     gcgcaagact gtaaccacgc gtctgttgac tggcaggtgg tggccaatgg tgatgtcagc
     gttgaactgc gtgatgcgga tcaacaggtg gttgcaactg gacaaggcac tagcgggact
     ttgcaagtgg tgaatccgca cctctggcaa ccgggtgaag gttatctcta tgaactgtgc
     gtcacagcca aaagccagac agagtgtgat atctacccgc ttcgcgtcgg catccggtca
     gtggcagtga agggcgaaca gttcctgatt aaccacaaac cgttctactt tactggcttt
     ggtcgtcatg aagatgcgga cttacgtggc aaaggattcg ataacgtgct gatggtgcac
     gaccacgcat taatggactg gattggggcc aactcctacc gtacctcgca ttacccttac
     gctgaagaga tgctcgactg ggcagatgaa catggcatcg tggtgattga tgaaactgct
     gctgtcggct ttaacctctc tttaggcatt ggtttcgaag cgggcaacaa gccgaaagaa
     ctgtacagcg aagaggcagt caacggggaa actcagcaag cgcacttaca ggcgattaaa
     gagctgatag cgcgtgacaa aaaccaccca agcgtggtga tgtggagtat tgccaacgaa
     ccggataccc gtccgcaagg tgcacgggaa tatttcgcgc cactggcgga agcaacgcgt
     aaactcgacc cgacgcgtcc gatcacctgc gtcaatgtaa tgttctgcga cgctcacacc
     gataccatca gcgatctctt tgatgtgctg tgcctgaacc gttattacgg atggtatgtc
     caaagcggcg atttggaaac ggcagagaag gtactggaaa aagaacttct ggcctggcag
     gagaaactgc atcagccgat tatcatcacc gaatacggcg tggatacgtt agccgggctg
     cactcaatgt acaccgacat gtggagtgaa gagtatcagt gtgcatggct ggatatgtat
     caccgcgtct ttgatcgcgt cagcgccgtc gtcggtgaac aggtatggaa tttcgccgat
     tttgcgacct cgcaaggcat attgcgcgtt ggcggtaaca agaaagggat cttcactcgc
     gaccgcaaac cgaagtcggc ggcttttctg ctgcaaaaac gctggactgg catgaacttc
     ggtgaaaaac cgcagcaggg aggcaaacaa tgaatcaaca actctcctgg cgcaccatcg
     tcggctacag cctcggaagg tcgactctag aggatcgcca tggatccact taacgttact
     gaaatcatca aacagcttga cgaatctgga tataagatcg ttggtgtcga tgtcagctcc
     ggagttgaga caaatggtgt tcaggatctc gataagatac gttcatttgt ccaagcagca
     aagagtgcct tctagtgatt taatagctcc atgtcaacaa gaataaaacg cgttttcggg
     tttacctctt ccagatacag ctcatctgca atgcattaat gcattgactg caacctagta
     acgccttnca ggctccggcg aagagaagaa tagcttagca gagctatttt cattttcggg
     agacgagatc aagcagatca acggtcgtca agagacctac gagactgagg aatccgctct
     tggctccacg cgactatata tttgtctcta attgtacttt gacatgctcc tcttctttac
     tctgatagct tgactatgaa aattccgtca ccagcncctg ggttcgcaaa gataattgca
     tgtttcttcc ttgaactctc aagcctacag gacacacatt catcgtaggt ataaacctcg
     aaatcanttc ctactaagat ggtatacaat agtaaccatg catggttgcc tagtgaatgc
     tccgtaacac ccaatacgcc ggccgaaact tttttacaac tctcctatga gtcgtttacc
     cagaatgcac aggtacactt gtttagaggt aatccttctt tctagaagtc ctcgtgtact
     gtgtaagcgc ccactccaca tctccactcg acctgcaggc atgcaagctt ggcactggcc
     gtcgttttac aacgtcgtga ctgggaaaac cctggcgtta cccaacttaa tcgccttgca
     gcacatcccc ctttcgccag ctggcgtaat agcgaagagg cccgcaccga tcgcccttcc
     caacagttgc gcagcctgaa tggcgaatgg cgcctgatgc ggtattttct ccttacgcat
     ctgtgcggta tttcacaccg catatggtgc actctcagta caatctgctc tgatgccgca
     tagttaagcc agccccgaca cccgccaaca cccgctgacg cgccctgacg ggcttgtctg
     ctcccggcat ccgcttacag acaagctgtg accgtctccg ggagctgcat gtgtcagagg
     ttttcaccgt catcaccgaa acgcgcgaga cgaaagggcc tcgtgatacg cctattttta
     taggttaatg tcatgataat aatggtttct tagacgtcag gtggcacttt tcggggaaat
     gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta tccgctcatg
     agacaataac cctgataaat gcttcaataa tattgaaaaa ggaagagtat gagtattcaa
     catttccgtg tcgcccttat tccctttttt gcggcatttt gccttcctgt ttttgctcac
     ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt tgggtgcacg agtgggttac
     atcgaactgg atctcaacag cggtaagatc cttgagagtt ttcgccccga agaacgtttt
     ccaatgatga gcacttttaa agttctgcta tgtggcgcgg tattatcccg tattgacgcc
     gggcaagagc aactcggtcg ccgcatacac tattctcaga atgacttggt tgagtactca
     ccagtcacag aaaagcatct tacggatggc atgacagtaa gagaattatg cagtgctgcc
     ataaccatga gtgataacac tgcggccaac ttacttctga caacgatcgg aggaccgaag
     gagctaaccg cttttttgca caacatgggg gatcatgtaa ctcgccttga tcgttgggaa
     ccggagctga atgaagccat accaaacgac gagcgtgaca ccacgatgcc tgtagcaatg
     gcaacaacgt tgcgcaaact attaactggc gaactactta ctctagcttc ccggcaacaa
     ttaatagact ggatggaggc ggataaagtt gcaggaccac ttctgcgctc ggcccttccg
     gctggctggt ttattgctga taaatctgga gccggtgagc gtgggtctcg cggtatcatt
     gcagcactgg ggccagatgg taagccctcc cgtatcgtag ttatctacac gacggggagt
     caggcaacta tggatgaacg aaatagacag atcgctgaga taggtgcctc actgattaag
     cattggtaac tgtcagacca agtttactca tatatacttt agattgattt aaaacttcat
     ttttaattta aaaggatcta ggtgaagatc ctttttgata atctcatgac caaaatccct
     taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa aggatcttct
     tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc accgctacca
     gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt aactggcttc
     agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg ccaccacttc
     aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc agtggctgct
     gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt accggataag
     gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga gcgaacgacc
     tacaccgaac tgagatacct acagcgtgag ctatgagaaa gcgccacgct tcccgaaggg
     agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg cacgagggag
     cttccagggg gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca cctctgactt
     gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa cgccagcaac
     gcggcctttt tacggttcct ggccttttgc tggccttttg ctcacatgtt ctttcctgcg
     ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga taccgctcgc
     cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga gcgcccaata
     cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca cgacaggttt
     cccgactgga aagcgggcag tgagcgcaac gcaattaatg tgagttagct cactcattag
     gcaccccagg ctttacactt tatgcttccg gctcgtatgt tgtgtggaat tgtgagcgga
     taacaatttc acacaggaaa cagctatgac catgattac
//