back Return to this vector's summary.
ID   PPCV       preliminary; circular DNA; SYN; 4382 BP.
XX
AC   IG9939;
XX
DT   01-JUL-1995 (Rel. 11, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pPCV - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pKO-II from pKO-1 & pPCV
RC   pKO-2 from pKO-II
RC   pKM-II from pKM-1 & pPCV
RC   pKM-2 from pKM-II
RA   De Boer H.A.;
RT   "A versatile plasmid system for the study of prokayotic
RT   transcription signals in Escherichia coli";
RL   Gene 30:251-255(1984).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   NM (pPCV)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (promoter analysis)
CC   SE ()
CC   PA (pBR322)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 ClaI 4361bp 25..25
FT                   2. oligo ClaI-SacI-XhoI-XbaI-ClaI 21bp
FT                   \ cggagctctcgagtctagaat
FT                   -> pPCV 4382bp [unique ClaI, no tet promoter]"
FT   -               1..24
FT                   /note="pBR322 1..24 24bp
FT                   ClaI = AT^CGAT"
FT   -               25..45
FT                   /note="cggagctctcgagtctagaat 21bp
FT                   ClaI = AT^CGAT"
FT   -               46..4382
FT                   /note="pBR322 25..4361 4337bp"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             3092..3880
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
XX
SQ   Sequence 4382 BP; 988 A; 1215 C; 1140 G; 1039 T; 0 other;
     ttctcatgtt tgacagctta tcatcggagc tctcgagtct agaatcgata agctttaatg
     cggtagttta tcacagttaa attgctaacg cagtcaggca ccgtgtatga aatctaacaa
     tgcgctcatc gtcatcctcg gcaccgtcac cctggatgct gtaggcatag gcttggttat
     gccggtactg ccgggcctct tgcgggatat cgtccattcc gacagcatcg ccagtcacta
     tggcgtgctg ctagcgctat atgcgttgat gcaatttcta tgcgcacccg ttctcggagc
     actgtccgac cgctttggcc gccgcccagt cctgctcgct tcgctacttg gagccactat
     cgactacgcg atcatggcga ccacacccgt cctgtggatc ctctacgccg gacgcatcgt
     ggccggcatc accggcgcca caggtgcggt tgctggcgcc tatatcgccg acatcaccga
     tggggaagat cgggctcgcc acttcgggct catgagcgct tgtttcggcg tgggtatggt
     ggcaggcccc gtggccgggg gactgttggg cgccatctcc ttgcatgcac cattccttgc
     ggcggcggtg ctcaacggcc tcaacctact actgggctgc ttcctaatgc aggagtcgca
     taagggagag cgtcgaccga tgcccttgag agccttcaac ccagtcagct ccttccggtg
     ggcgcggggc atgactatcg tcgccgcact tatgactgtc ttctttatca tgcaactcgt
     aggacaggtg ccggcagcgc tctgggtcat tttcggcgag gaccgctttc gctggagcgc
     gacgatgatc ggcctgtcgc ttgcggtatt cggaatcttg cacgccctcg ctcaagcctt
     cgtcactggt cccgccacca aacgtttcgg cgagaagcag gccattatcg ccggcatggc
     ggccgacgcg ctgggctacg tcttgctggc gttcgcgacg cgaggctgga tggccttccc
     cattatgatt cttctcgctt ccggcggcat cgggatgccc gcgttgcagg ccatgctgtc
     caggcaggta gatgacgacc atcagggaca gcttcaagga tcgctcgcgg ctcttaccag
     cctaacttcg atcactggac cgctgatcgt cacggcgatt tatgccgcct cggcgagcac
     atggaacggg ttggcatgga ttgtaggcgc cgccctatac cttgtctgcc tccccgcgtt
     gcgtcgcggt gcatggagcc gggccacctc gacctgaatg gaagccggcg gcacctcgct
     aacggattca ccactccaag aattggagcc aatcaattct tgcggagaac tgtgaatgcg
     caaaccaacc cttggcagaa catatccatc gcgtccgcca tctccagcag ccgcacgcgg
     cgcatctcgg gcagcgttgg gtcctggcca cgggtgcgca tgatcgtgct cctgtcgttg
     aggacccggc taggctggcg gggttgcctt actggttagc agaatgaatc accgatacgc
     gagcgaacgt gaagcgactg ctgctgcaaa acgtctgcga cctgagcaac aacatgaatg
     gtcttcggtt tccgtgtttc gtaaagtctg gaaacgcgga agtcagcgcc ctgcaccatt
     atgttccgga tctgcatcgc aggatgctgc tggctaccct gtggaacacc tacatctgta
     ttaacgaagc gctggcattg accctgagtg atttttctct ggtcccgccg catccatacc
     gccagttgtt taccctcaca acgttccagt aaccgggcat gttcatcatc agtaacccgt
     atcgtgagca tcctctctcg tttcatcggt atcattaccc ccatgaacag aaatccccct
     tacacggagg catcagtgac caaacaggaa aaaaccgccc ttaacatggc ccgctttatc
     agaagccaga cattaacgct tctggagaaa ctcaacgagc tggacgcgga tgaacaggca
     gacatctgtg aatcgcttca cgaccacgct gatgagcttt accgcagctg cctcgcgcgt
     ttcggtgatg acggtgaaaa cctctgacac atgcagctcc cggagacggt cacagcttgt
     ctgtaagcgg atgccgggag cagacaagcc cgtcagggcg cgtcagcggg tgttggcggg
     tgtcggggcg cagccatgac ccagtcacgt agcgatagcg gagtgtatac tggcttaact
     atgcggcatc agagcagatt gtactgagag tgcaccatat gcggtgtgaa ataccgcaca
     gatgcgtaag gagaaaatac cgcatcaggc gctcttccgc ttcctcgctc actgactcgc
     tgcgctcggt cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt
     tatccacaga atcaggggat aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg
     ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca taggctccgc ccccctgacg
     agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga ctataaagat
     accaggcgtt tccccctgga agctccctcg tgcgctctcc tgttccgacc ctgccgctta
     ccggatacct gtccgccttt ctcccttcgg gaagcgtggc gctttctcat agctcacgct
     gtaggtatct cagttcggtg taggtcgttc gctccaagct gggctgtgtg cacgaacccc
     ccgttcagcc cgaccgctgc gccttatccg gtaactatcg tcttgagtcc aacccggtaa
     gacacgactt atcgccactg gcagcagcca ctggtaacag gattagcaga gcgaggtatg
     taggcggtgc tacagagttc ttgaagtggt ggcctaacta cggctacact agaaggacag
     tatttggtat ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt
     gatccggcaa acaaaccacc gctggtagcg gtggtttttt tgtttgcaag cagcagatta
     cgcgcagaaa aaaaggatct caagaagatc ctttgatctt ttctacgggg tctgacgctc
     agtggaacga aaactcacgt taagggattt tggtcatgag attatcaaaa aggatcttca
     cctagatcct tttaaattaa aaatgaagtt ttaaatcaat ctaaagtata tatgagtaaa
     cttggtctga cagttaccaa tgcttaatca gtgaggcacc tatctcagcg atctgtctat
     ttcgttcatc catagttgcc tgactccccg tcgtgtagat aactacgata cgggagggct
     taccatctgg ccccagtgct gcaatgatac cgcgagaccc acgctcaccg gctccagatt
     tatcagcaat aaaccagcca gccggaaggg ccgagcgcag aagtggtcct gcaactttat
     ccgcctccat ccagtctatt aattgttgcc gggaagctag agtaagtagt tcgccagtta
     atagtttgcg caacgttgtt gccattgctg caggcatcgt ggtgtcacgc tcgtcgtttg
     gtatggcttc attcagctcc ggttcccaac gatcaaggcg agttacatga tcccccatgt
     tgtgcaaaaa agcggttagc tccttcggtc ctccgatcgt tgtcagaagt aagttggccg
     cagtgttatc actcatggtt atggcagcac tgcataattc tcttactgtc atgccatccg
     taagatgctt ttctgtgact ggtgagtact caaccaagtc attctgagaa tagtgtatgc
     ggcgaccgag ttgctcttgc ccggcgtcaa cacgggataa taccgcgcca catagcagaa
     ctttaaaagt gctcatcatt ggaaaacgtt cttcggggcg aaaactctca aggatcttac
     cgctgttgag atccagttcg atgtaaccca ctcgtgcacc caactgatct tcagcatctt
     ttactttcac cagcgtttct gggtgagcaa aaacaggaag gcaaaatgcc gcaaaaaagg
     gaataagggc gacacggaaa tgttgaatac tcatactctt cctttttcaa tattattgaa
     gcatttatca gggttattgt ctcatgagcg gatacatatt tgaatgtatt tagaaaaata
     aacaaatagg ggttccgcgc acatttcccc gaaaagtgcc acctgacgtc taagaaacca
     ttattatcat gacattaacc tataaaaata ggcgtatcac gaggcccttt cgtcttcaag
     aa
//