back Return to this vector's summary.
ID   PPM668     preliminary; circular DNA; SYN; 8285 BP.
XX
AC   IG9855;
XX
DT   01-JUL-1995 (Rel. 11, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Saccharomyces/E.coli plasmid vector pPM668 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   plasmid from YIp5
RC   pPM662 from plasmid & YCp19
RC   pPM664 from pPM662 & linker & pSU4-A, sup4-o gene
RC   pPM668 from pPM664
RC   pYAC2 from pPM668 & linker & A240p1
RC   pYAC3 from pYAC2
RC   pYAC4 from pYAC3 & linker
RC   pYAC5, pYAC55 from pYAC3 & linker
RA   Burke D.T., Carle G.F., Olson M.V.;
RT   "Cloning of large segments of exogenous DNA into yeast by means of
RT   artificial chromosome vectors";
RL   Science 236:806-812(1987).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   NM (pPM668)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli RR1)(Saccharomyces cerevisiae)(E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (YIp5)(YCp19)(yeast sup4-o gene)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. YIp5 AvaI 5541bp 2541..2541, URA3 gene
FT                   fill in
FT                   -> plasmid 5541bp [no SmaI at 2543 in URA3]
FT                   1. plasmid EcoRI-PvuII 3248bp 2..3250, pBR322 part
FT                   :Klenow
FT                   2. YCp19 PvuII 10600bp 4711..4711, ARS1/TRP1/CEN4
FT                   -> pPM662 11600bp
FT                   \ [PvuII, ori, amp, ARS1, TRP1, CEN4, URA3]
FT                   1. yeast, sup4-o gene
FT                   -> pSU4-A
FT                   1. pPM662 BamHI 11600bp, YRp17 1840..1840
FT                   fill in
FT                   2. pSU4-A AluI-AluI 262bp, SUP4-o gene
FT                   \ 42bp
FT                   \ aattccctttagtataaatttcactctgaaccatcttggaag
FT                   \ #J01381 202bp
FT                   \ gaccggataattatttgaaatgtgtttttcaattgtatatgtgttatgta
FT                   \ gtatactctttcttcaacaattaaatactctcggtagccaagttggttta
FT                   \ aggcgcaagactttaatttatcactacgaaatcttgagatcgggcgttcg
FT                   \ actcgcccccgggagatttttttgttttttatgtctccattcacttcccaga
FT                   \ 33bp
FT                   \ cttgcaagttgaaatatttctttcaagggaatt
FT                   SfiI-NotI linker 17bp gcggccgcsgcggccgc:NotI-SfiI
FT                   \ linker 17bp gcggccgcsgcggccgc
FT                   -> pPM664 11900bp
FT                   1. pPM664 remove EcoRI-KpnI 3600bp, CEN4/YIp5 EcoRI 2
FT                   \ 8285bp
FT                   Klenow:Klenow
FT                   -> plasmid 8285bp
FT                   1. plasmid EcoRI 8285bp, CEN4/YIp5 EcoRI 2
FT                   fill in
FT                   -> pPM668 8285bp [no XhoI in CEN4]"
FT   -               1..296
FT                   /note="pYAC4 1..296 296bp
FT                   SfiI =    GGCCNNNN^NGGCC
FT                   NotI = GC^GGCCGC
FT                   \      gcggccgcsgcggccgc"
FT   -               297..313
FT                   /note="gcggccgcsgcggccgc 17bp
FT                   \      gcggccgcsgcggccgc
FT                   NotI = GC^GGCCGC
FT                   SfiI =    GGCCNNNN^NGGCC"
FT   -               314..559
FT                   /note="pYAC4 307..552 246bp"
FT   -               560..562
FT                   /note="gaa 3bp"
FT   -               563..691
FT                   /note="pYAC4 564..692 129bp
FT                   SfiI =    GGCCNNNN^NGGCC
FT                   NotI = GC^GGCCGC
FT                   \      gcggccgcsgcggccgc"
FT   -               692..708
FT                   /note="gcggccgcsgcggccgc 17bp
FT                   \      gcggccgcsgcggccgc
FT                   NotI = GC^GGCCGC
FT                   SfiI =    GGCCNNNN^NGGCC"
FT   -               709..3541
FT                   /note="pYAC4 700..3532 2833bp
FT                   XhoI = C^TCGAG"
FT   -               3542..8285
FT                   /note="pYAC4 6711..11454 4744bp"
FT   misc_binding    0..0
FT                   /note="SIT unique SmaI"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   rep_origin      0..0
FT                   /note="ORI yeast ARS1"
FT   misc_feature    0..0
FT                   /note="yeast centromere CEN4"
FT   CDS             0..0
FT                   /note="ANT yeast SUP4 gene (ochre suppressor)"
FT   CDS             0..0
FT                   /note="ANT yeast TRP1 gene"
FT   CDS             0..0
FT                   /note="ANT yeast URA3 gene"
XX
SQ   Sequence 8285 BP; 2216 A; 1879 C; 1939 G; 2249 T; 2 other;
     ttctcatgtt tgacagctta tcatcgataa gctttaatgc ggtagtttat cacagttaaa
     ttgctaacgc agtcaggcac cgtgtatgaa atctaacaat gcgctcatcg tcatcctcgg
     caccgtcacc ctggatgctg taggcatagg cttggttatg ccggtactgc cgggcctctt
     gcgggatatc gtccattccg acagcatcgc cagtcactat ggcgtgctgc tagcgctata
     tgcgttgatg caatttctat gcgcacccgt tctcggagca ctgtccgacc gctttggcgg
     ccgcsgcggc cgcagtcctg ctcgcttcgc tacttggagc cactatcgac tacgcgatca
     tggcgaccac acccgtcctg tggatcaatt ccctttagta taaatttcac tctgaaccat
     cttggaagga ccggtaatta tttcaaatct ctttttcaat tgtatatgtg ttatgttatg
     tagtatactc tttcttcaac aattaaatac tctcggtagc caagttggtt taaggcgcaa
     gactttaatt tatcactacg aaatcttgag atcgggcgtt cgatcgcccc gggagatttt
     tttgtttttt atgtcttcca ttcacttccc agacttgcaa gttgaaatat ttctttcaag
     ggaattgatc ctctacgccg gacgcatcgt ggcggccgcs gcggccgctc accggcgcca
     caggtgcggt tgctggcgcc tatatcgccg acatcaccga tggggaagat cgggctcgcc
     acttcgggct catgagcgct tgtttcggcg tgggtatggt ggcaggcccc gtggccgggg
     gactgttggg cgccatctcc ttgcatgcac cattccttgc ggcggcggtg ctcaacggcc
     tcaacctact actgggctgc ttcctaatgc aggagtcgca taagggagag cgtcgaccga
     tgcccttgag agccttcaac ccagtcagct ccttccggtg ggcgcggggc atgactatcg
     tcgccgcact tatgactgtc ttctttatca tgcaactcgt aggacaggtg ccggcagcgc
     tctgggtcat tttcggcgag gaccgctttc gctggagcgc gacgatgatc ggcctgtcgc
     ttgcggtatt cggaatcttg cacgccctcg ctcaagcctt cgtcactggt cccgccacca
     aacgtttcgg cgagaagcag gccattatcg ccggcatggc ggccgacgcg ctgggctacg
     tcttgctggc gttcgcgacg cgaggctgga tggccttccc cattatgatt cttctcgctt
     ccggcggcat cgggatgccc gcgttgcagg ccatgctgtc caggcaggta gatgacgacc
     atcagggaca gcttcaagga tcgctcgcgg ctcttaccag cctaacttcg atcactggac
     cgctgatcgt cacggcgatt tatgccgcct cggcgagcac atggaacggg ttggcatgga
     ttgtaggcgc cgccctatac cttgtctgcc tccccgcgtt gcgtcgcggt gcatggagcc
     gggccacctc gacctgaatg gaagccggcg gcacctcgct aacggattca ccactccaag
     aattggagcc aatcaattct tgcggagaac tgtgaatgcg caaaccaacc cttggcagaa
     catatccatc gcgtccgcca tctccagcag ccgcacgcgg cgcatccccc cccccctttc
     aattcaattc atcatttttt ttttattctt ttttttgatt tcggtttctt tgaaattttt
     ttgattcggt aatctccgaa cagaaggaag aacgaaggaa ggagcacaga cttagattgg
     tatatatacg catatgtagt gttgaagaaa catgaaattg cccagtattc ttaacccaac
     tgcacagaac aaaaacctgc aggaaacgaa gataaatcat gtcgaaagct acatataagg
     aacgtgctgc tactcatcct agtcctgttg ctgccaagct atttaatatc atgcacgaaa
     agcaaacaaa cttgtgtgct tcattggatg ttcgtaccac caaggaatta ctggagttag
     ttgaagcatt aggtcccaaa atttgtttac taaaaacaca tgtggatatc ttgactgatt
     tttccatgga gggcacagtt aagccgctaa aggcattatc cgccaagtac aattttttac
     tcttcgaaga cagaaaattt gctgacattg gtaatacagt caaattgcag tactctgcgg
     gtgtatacag aatagcagaa tgggcagaca ttacgaatgc acacggtgtg gtgggcccag
     gtattgttag cggtttgaag caggcggcag aagaagtaac aaaggaacct agaggccttt
     tgatgttagc agaattgtca tgcaagggct ccctatctac tggagaatat actaagggta
     ctgttgacat tgcgaagagc gacaaagatt ttgttatcgg ctttattgct caaagagaca
     tgggtggaag agatgaaggt tacgattggt tgattatgac acccggtgtg ggtttagatg
     acaagggaga cgcattgggt caacagtata gaaccgtgga tgatgtggtc tctacaggat
     ctgacattat tattgttgga agaggactat ttgcaaaggg aagggatgct aaggtagagg
     gtgaacgtta cagaaaagca ggctgggaag catatttgag aagatgcggc cagcaaaact
     aaaaaactgt attataagta aatgcatgta tactaaactc acaaattaga gcttcaattt
     aattatatca gttattactc gggcgtaatg atttttataa tgacgaaaaa aaaaaaattg
     gaaagaaaag gggggggggg cagcgttggg tcctggccac gggtgcgcat gatcgtgctc
     ctgtcgttga ggacccggct aggctggcgg ggttgcctta ctggttagca gaatgaatca
     ccgatacgcg agcgaacgtg aagcgactgc tgctgcaaaa cgtctgcgac ctgagcaaca
     acatgaatgg tcttcggttt ccgtgtttcg taaagtctgg aaacgcggaa gtcagcgccc
     tgcaccatta tgttccggat ctgcatcgca ggatgctgct ggctaccctg tggaacacct
     acatctgtat taacgaagcg ctggcattga ccctgagtga tttttctctg gtcccgccgc
     atccataccg ccagttgttt accctcacaa cgttccagta accgggcatg ttcatcatca
     gtaacccgta tcgtgagcat cctctctcgt ttcatcggta tcattacccc catgaacaga
     aattccccct tacacggagg catcaagtga ccaaacagga aaaaaccgcc cttaacatgg
     cccgctttat cagaagccag acattaacgc ttctggagaa actcaacgag ctggacgcgg
     atgaacaggc agacatctgt gaatcgcttc acgaccacgc tgatgagctt taccgcagcc
     ctcgagggct gcctcgcgcg tttcggtgat gacggtgaaa acctctgaca catgcagctc
     ccggagacgg tcacagcttg tctgtaagcg gatgccggga gcagacaagc ccgtcagggc
     gcgtcagcgg gtgttggcgg gtgtcggggc gcagccatga cccagtcacg tagcgatagc
     ggagtgtata ctggcttaac tatgcggcat cagagcagat tgtactgaga gtgcaccata
     tgcggtgtga aataccgcac agatgcgtaa ggagaaaata ccgcatcagg cgctcttccg
     cttcctcgct cactgactcg ctgcgctcgg tcgttcggct gcggcgagcg gtatcagctc
     actcaaaggc ggtaatacgg ttatccacag aatcagggga taacgcagga aagaacatgt
     gagcaaaagg ccagcaaaag gccaggaacc gtaaaaaggc cgcgttgctg gcgtttttcc
     ataggctccg cccccctgac gagcatcaca aaaatcgacg ctcaagtcag aggtggcgaa
     acccgacagg actataaaga taccaggcgt ttccccctgg aagctccctc gtgcgctctc
     ctgttccgac cctgccgctt accggatacc tgtccgcctt tctcccttcg ggaagcgtgg
     cgctttctca tagctcacgc tgtaggtatc tcagttcggt gtaggtcgtt cgctccaagc
     tgggctgtgt gcacgaaccc cccgttcagc ccgaccgctg cgccttatcc ggtaactatc
     gtcttgagtc caacccggta agacacgact tatcgccact ggcagcagcc actggtaaca
     ggattagcag agcgaggtat gtaggcggtg ctacagagtt cttgaagtgg tggcctaact
     acggctacac tagaaggaca gtatttggta tctgcgctct gctgaagcca gttaccttcg
     gaaaaagagt tggtagctct tgatccggca aacaaaccac cgctggtagc ggtggttttt
     ttgtttgcaa gcagcagatt acgcgcagaa aaaaaggatc tcaagaagat cctttgatct
     tttctacggg gtctgacgct cagtggaacg aaaactcacg ttaagggatt ttggtcatga
     gattatcaaa aaggatcttc acctagatcc ttttaaatta aaaatgaagt tttaaatcaa
     tctaaagtat atatgagtaa acttggtctg acagttacca atgcttaatc agtgaggcac
     ctatctcagc gatctgtcta tttcgttcat ccatagttgc ctgactcccc gtcgtgtaga
     taactacgat acgggagggc ttaccatctg gccccagtgc tgcaatgata ccgcgagacc
     cacgctcacc ggctccagat ttatcagcaa taaaccagcc agccggaagg gccgagcgca
     gaagtggtcc tgcaacttta tccgcctcca tccagtctat taattgttgc cgggaagcta
     gagtaagtag ttcgccagtt aatagtttgc gcaacgttgt tgccattgct gcaggcatcg
     tggtgtcacg ctcgtcgttt ggtatggctt cattcagctc cggttcccaa cgatcaaggc
     gagttacatg atcccccatg ttgtgcaaaa aagcggttag ctccttcggt cctccgatcg
     ttgtcagaag taagttggcc gcagtgttat cactcatggt tatggcagca ctgcataatt
     ctcttactgt catgccatcc gtaagatgct tttctgtgac tggtgagtac tcaaccaagt
     cattctgaga atagtgtatg cggcgaccga gttgctcttg cccggcgtca acacgggata
     ataccgcgcc acatagcaga actttaaaag tgctcatcat tggaaaacgt tcttcggggc
     gaaaactctc aaggatctta ccgctgttga gatccagttc gatgtaaccc actcgtgcac
     ccaactgatc ttcagcatct tttactttca ccagcgtttc tgggtgagca aaaacaggaa
     ggcaaaatgc cgcaaaaaag ggaataaggg cgacacggaa atgttgaata ctcatactct
     tcctttttca atattattga agcatttatc agggttattg tctcatgagc ggatacatat
     ttgaatgtat ttagaaaaat aaacaaatag gggttccgcg cacatttccc cgaaaagtgc
     cacctgacgt ctaagaaacc attattatca tgacattaac ctataaaaat aggcgtatca
     cgaggccctt tcgtcttcaa gaattaattc ggtcgaaaaa agaaaaggag agggccaaga
     gggagggcat tggtgactat tgagcacgtg agtatacgtg attaagcaca caaaggcagc
     ttggagtatg tctgttatta atttcacagg tagttctggt ccattggtga aagtttgcgg
     cttgcagagc acagaggccg cagaatgtgc tctagattcc gatgctgact tgctgggtat
     tatatgtgtg cccaatagaa agagaacaat tgacccggtt attgcaagga aaatttcaag
     tcttgtaaaa gcatataaaa atagttcagg cactccgaaa tacttggttg gcgtgtttcg
     taatcaacct aaggaggatg ttttggctct ggtcaatgat tacggcattg atatcgtcca
     actgcatgga gatgagtcgt ggcaagaata ccaagagttc ctcggtttgc cagttattaa
     aagactcgta tttccaaaag actgcaacat actactcagt gcagcttcac agaaacctca
     ttcgtttatt cccttgtttg attcagaagc aggtgggaca ggtgaacttt tggattggaa
     ctcgatttct gactgggttg gaaggcaaga gagccccgaa agcttacatt ttatgttagc
     tggtggactg acgccagaaa atgttggtga tgcgcttaga ttaaatggcg ttattggtgt
     tgatgtaagc ggaggtgtgg agacaaatgg tgtaaaagac tctaacaaaa tagcaaattt
     cgtcaaaaat gctaagaaat aggttattac tgagtagtat ttatttaagt attgtttgtg
     cacttgcctg caggcctttt gaaaagcaag cataaaagat ctaaacataa aatctgtaaa
     ataacaagat gtaaagataa tgctaaatca tttggctttt tgattgattg tacaggaaaa
     tatacatcgc agggggttga cttttaccat ttcaccgcaa tggaatcaaa cttgttgaag
     agaatgttca caggcgcata cgctacaatg acccgattct tgctagcctt ttctcggtct
     tgcaaacaac cgccggcagc ttagtatata aatacacatg tacatacctc tctccgtatc
     ctcgtaatca ttttcttgta tttatcgtct tttcgctgta aaaactttat cacacttatc
     tcaaatacac ttattaaccg cttttactat tatcttctac gctgacagta atatcaaaca
     gtgacacata ttaaacacag tggtttcttt gcataaacac catcagcctc aagtcgtcaa
     gtaaagattt cgtgttcatg cagatagata acaatctata tgttgataat tagcgttgcc
     tcatcaatgc gagatccgtt taaccggacc ctagtgcact taccccacgt tcggtccact
     gtgtgccgaa catgctcctt cactatttta acatgtggaa ttaattctaa atcctcttta
     tatgatctgc cgatagatag ttctaagtca ttgaggttca tcaacaattg gattttctgt
     ttactcgact tcaggtaaat gaaatgagat gatacttgct tatctcatag ttaactctaa
     gaggtgatac ttatttactg taaaactgtg acgataaaac cggaaggaag aataagaaaa
     ctcgaactga tctataatgc ctattttctg taaagagttt aagctatgaa agcctcggca
     ttttggccgc tcctaggtag tgcttttttt ccaaggacaa aacagtttct ttttcttgag
     caggttttat gtttcggtaa tcataaacaa taaataaatt atttcattta tgtttaaaaa
     taaaaaataa aaaagtattt taaattttta aaaaagttga ttataagcat gtgacctttt
     gcaagcaatt aaattttgca atttgtgatt ttaggcaaaa gttacaattt ctggctcgtg
     taatatatgt atgctaaagt gaacttttac aaagtcgata tggacttagt caaaagaaat
     tttcttaaaa atatatagca ctagccaatt tagcacttct ttatgagata tattatagac
     tttattaagc cagatttgtg tattatatgt atttacccgg cgaatcatgg acatacattc
     tgaaataggt aatattctct atggtgagac agcatagata acctaggata caagttaaaa
     gctagtactg ttttgcagta atttttttct tttttataag aatgttacca cctaaataag
     ttataaagtc aatagttaag tttgatattt gattgtaaaa taccgtaata tatttgcatg
     atcaaaaggc tcaatgttga ctagccagca tgtcaaccac tatattgatc accgatatat
     ggacttccac accaactagt aatatgacaa taaattcaag atattcttca tgagaatggc
     ccaga
//