back Return to this vector's summary.
ID   PPOLYIIII  preliminary; circular DNA; SYN; 2117 BP.
XX
AC   M18131; M18132;
XX
DT   16-JUL-1988 (Rel. 3, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pPolyIII-I - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-137
RC   ptg190 from pML2 & pUC8
RC   ptg191 from ptg190
RC   pPolyI or ptg1poly from ptg191 & M13tg131
RC   pPolyI+ from pPolyI & linker
RC   pPolyI+B0 from pPolyI+ & linker
RC   pPolyII from pPolyI+B0 & oligo
RC   M13-sn-19 from M13mp18 & oligo
RC   pPolyII-sn-14 from M13-sn-19 & pPolyII
RC   pPolyIII from pPolyII & M13-sn-19
RC   pPolyIII-I, pPolyIII-D from pPolyII-sn-14 & M13-sn-19
RC   pPolyIII-I-AMP, pPolyIII-I-ORI from M13tg119 & pPolyIII-I
RC   pPolyIII-D-AMP, pPolyIII-D-ORI from M13tg119 & pPolyIII-D
RC   EMBL301 or ABRO1, EMBL302 from EMBL3 & M13-sn-19
RA   Lathe R., Vilotte J.L., Clark A.J.;
RT   "Plasmid and bacteriophage vectors for excision of intact
RT   inserts";
RL   Gene 57:193-201(1987).
XX
RN   [2]
RP   1-2117
RC   pPolyIII-I; revises [1]
RA   Lathe R.;
RT   ;
RL   Submitted (26-SEP-1988) to GenBank on computer-readable media by:
RL   Lathe R., LGME-CNRS & U184 INSERM 67085 Strasbourg, France.
XX
CC   NM (pPolyIII-I)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pML2)
CC   BR (pPolyI)(pPolyII)
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. M13mp18 remove BamHI-SalI 12bp 6252..6264,
FT                   \ MCS/7237bp
FT                   2. oligo BamHI-XhoI-SfiI-NaeI-NotI-BglII-SalI 34bp
FT                   \ tcgacagatctgcggccgccggcctcgagggccg
FT                   -> M13-sn-19 7271bp
FT                   1. pPolyII BglII 2061bp 77..77
FT                   phosphatase
FT                   2. M13-sn-19 BamHI-BglII 30bp, sn segment
FT                   -> pPolyII-sn-14 2100bp [BamHI-SfiI-NotI-BglII]
FT                   1. pPolyII BamHI 2061bp 2..2
FT                   2. M13-sn-19 BamHI-BglII 30bp, sn segment
FT                   -> pPolyIII 2117bp [inverted repeat]"
FT   misc_feature    105..136
FT                   /note="synthetic DNA insert"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 2117 BP; 517 A; 553 C; 520 G; 527 T; 0 other;
     ggatctgcgg ccgccggcct cgagggccgg atccgaattc ccgggagagc tcgatatcgc
     atgcggtacc tctagaagaa gcttggccag ctggtcgacc tgcagatccg gccctcgagg
     ccggcggccg cagatctgcg acgcgaggct ggatggcctt ccccattatg attcttctcg
     cttccggcgg catcgggatg cccgcgttgc aggccatgct gtccaggcag gtagatgacg
     accatcaggg acagcttcac ggccagcaaa aggccaggaa ccgtaaaaag gccgcgttgc
     tggcgttttt ccataggctc cgcccccctg acgagcatca caaaaatcga cgctcaagtc
     agaggtggcg aaacccgaca ggactataaa gataccaggc gtttccccct ggaagctccc
     tcgtgcgctc tcctgttccg accctgccgc ttaccggata cctgtccgcc tttctccctt
     cgggaagcgt ggcgctttct caatgctcac gctgtaggta tctcagttcg gtgtaggtcg
     ttcgctccaa gctgggctgt gtgcacgaac cccccgttca gcccgaccgc tgcgccttat
     ccggtaacta tcgtcttgag tccaacccgg taagacacga cttatcgcca ctggcagcag
     ccactggtaa caggattagc agagcgaggt atgtaggcgg tgctacagag ttcttgaagt
     ggtggcctaa ctacggctac actagaagga cagtatttgg tatctgcgct ctgctgaagc
     cagttacctt cggaaaaaga gttggtagct cttgatccgg caaacaaacc accgctggta
     gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag aaaaaaagga tctcaagaag
     atcctttgat cttttctacg gggtctgacg ctcagtggaa cgaaaactca cgttaaggga
     ttttggtcat gagattatca aaaaggatct tcacctagat ccttttaaat caatctaaag
     tatatatgag taaacttggt ctgacagtta ccaatgctta atcagtgagg cacctatctc
     agcgatctgt ctatttcgtt catccatagt tgcctgactc cccgtcgtgt agataactac
     gatacgggag ggcttaccat ctggccccag tgctgcaatg ataccgcgag acccacgctc
     accggctcca gatttatcag caataaacca gccagccgga agggccgagc gcagaagtgg
     tcctgcaact ttatccgcct ccatccagtc tattaattgt tgccgggaag ctagagtaag
     tagttcgcca gttaatagtt tgcgcaacgt tgttgccatt gtgcaggcat cgtggtgtca
     cgctcgtcgt ttggtatggc ttcattcagc tccggttccc aacgatcaag gcgagttaca
     tgatccccca tgttgtgcaa aaaagcggtt agctccttcg gtcctccgat cgttgtcaga
     agtaagttgg ccgcagtgtt atcactcatg gttatggcag cactgcataa ttctcttact
     gtcatgccat ccgtaagatg cttttctgtg actggtgagt actcaaccaa gtcattctga
     gaatagtgta tgcggcgacc gagttgctct tgcccggcgt caacacggga taataccgcg
     ccacatagca gaactttaaa agtgctcatc attggaaaac gttcttcggg gcgaaaactc
     tcaaggatct taccgctgtt gagatccagt tcgatgtaac ccactcgtgc acccaactga
     tcttcagcat cttttacttt caccagcgtt tctgggtgag caaaaacagg aaggcaaaat
     gccgcaaaaa agggaataag ggcgacacgg aaatgttgaa tactcatact cttccttttt
     caatattatt gaagcattta tcagggttat tgtctcatga gcggatacat atttgaatgt
     atttagaaaa ataaacaaat aggggttccg cgcacatttc cccgaaaagt gccacctgac
     gtctaagaaa ccattattat catgacatta acctataaaa ataggcgtat cacgaggccc
     tttcgtcttc aagaatt
//