back Return to this vector's summary.
ID   PREP10     preliminary; circular DNA; SYN; 8503 BP.
XX
AC   IG1105; K01383;
XX
DT   01-FEB-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pREP10 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pcDV1/S2 from pcDV1 & linker
RC   pRSVCAT/H2 from pRSVcat & linker
RC   [pBT from BT gene]
RC   pRSV/BT from pRSVCAT/H2 & pBT
RC   pRSVPA1 from pRSV/BT & pcDV1/S2
RC   pRSVPA2 from pRSVPA1 & linker
RC   p220.2 from p201
RC   p220.2/B- from p220.2
RC   pREP2 from pRSVPA2 & p220.2/B-
RC   pREP3 from pREP2
RC   p220.2/XS from p220.2/B-
RC   pHS1PA4 from pRSVPA2
RC   pMEP4 from p220.2/XS & pHS1PA4
RC   pRSVCAT-B2 from pRSVcat & linker
RC   pRSVCAT-B2K from pRSVCAT-B2 & linker
RC   pREP4 from pRSVCAT-B2K & pMEP4
RC   pREP5 from pREP4 & oligo
RA   Groger R.K., Morrow D.M., Tykocinski M.L.;
RT   "Directional antisense and sense cDNA cloning using Epstein-Barr
RT   virus episomal expression vectors";
RL   Gene 81:285-294(1989).
XX
CC   NM (pREP10)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (Invitrogen)
CC   HO (E.coli NM522)(E.coli INValphaF')(mammal)
CC   CP ()
CC   FN (expression)
CC   SE ()
CC   PA (EBV)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pREP4 KpnI-BamHI 10128bp 462..10183..407
FT                   2. oligo
FT                   BamHI-NaeI-StuI-XhoI-NotI-NheI-HindIII-PvuII-KpnI 60bp
FT                   \ gatcggtaccagctgaagcttgctagcggccgctcgaggccggcaaggcc
FT                   \ ggatccgtac
FT                   -> pREP5 10188bp
FT                   1. pREP5 remove, 10188bp-
FT                   -> pREP10 8503bp"
FT   misc_binding    1..1
FT                   /note="SIT XbaI"
FT   polyA_signal    0..0
FT                   /note="PLA SV40 early gene"
FT   misc_binding    0..0
FT                   /note="MCS
FT                   KpnI-PvuII-NheI-HindIII-NheI-NotI-XhoI-SfiI-BamHI"
FT   promoter        complement(0..0)
FT                   /note="PRO Rous sarcoma virus (RSV) long terminal
FT                   repeat (LTR)"
FT   polyA_signal    0..0
FT                   /note="PLA SV40 thymidine kinase (TK) gene"
FT   CDS             complement(0..0)
FT                   /note="ANT E. coli hygromycin phosphotransferase gene;
FT                   hygromycin resistance gene (hyg)"
FT   promoter        complement(0..0)
FT                   /note="PRO SV40 thymidine kinase (TK) gene"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             complement(0..0)
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   misc_binding    4826..4826
FT                   /note="SIT XmnI"
FT   misc_binding    5249..5249
FT                   /note="SIT ClaI"
FT   misc_binding    5395..5395
FT                   /note="SIT StuI"
FT   CDS             0..0
FT                   /note="GEN Epstein-Barr virus nuclear antigen gene
FT                   (EBNA-1)"
FT   misc_binding    6411..6411
FT                   /note="SIT SacI"
FT   rep_origin      0..0
FT                   /note="ORI Epstein-Barr virus (EBV) oriP"
FT   misc_binding    8840..8840
FT                   /note="SIT EcoRV"
XX
SQ   Sequence 8503 BP; 2069 A; 2212 C; 2260 G; 1962 T; 0 other;
     tattgtatcg agctaggcac ttaaatacaa ttatctctgc aatgcggaat tcagtggttc
     gtccaatcca tgtcagacct gtctgttgcc ttcctaataa ggcacgatcg taccacctta
     cttccaccaa tcggcatgca cggtgctttt tctctccttg taaggcatgt tgctaactca
     tcgttaccat gttgcaagac tacaagtgta ttgcataaga ctacatttcc ccctccctat
     gcaaaagcga aactactata tcctgagggg actcctaacc gcgtacaacc gaagccccgc
     tgggcgccta aacacaccct agtcccctca gatacgcgta tatctggccc gtacatcgcg
     aagcagcgca aaacgcctaa ccctaagcag attcttcatg caattgtcgg tcaagccttg
     ccttgttgta gcttaaattt tgctcgcgca ctactcagcg acctccaaca cacaagcagg
     gagcagatac tggcttaact atgcggcagc agagcagatt gtactgagag tgcaccatac
     aagctcagga tctgcgatga taagctgtca aacatgagaa ttggtcgacc actgggcgcc
     agaaatccgc gcggtggttt ttgggggtcg ggggtgtttg gcagccacag acgcccggtg
     ttcgtgtcgc gccagtacat gcggtccatg cccaggccat ccaaaaacca tgggtctgtc
     tgctcagtcc agtcgtggac cagaccccac gcaacgccca aaataataac ccccacgaac
     cataaaccat tccccatggg ggaccccgtc cctaacccac ggggccagtg gctatggcag
     ggcctgccgc cccgacgttg gctgcgagcc ctgggccttc acccgaactt ggggggtggg
     gtggggaaaa ggaagaaacg cgggcgtatt ggccccaatg gggtctcggt ggggtatcga
     cagagtgcca gccctgggac cgaaccccgc gtttatgaac aaacgaccca acacccgtgc
     gttttattct gtctttttat tgccgtcata gcgcgggttc cttccggtat tgtctccttc
     cgtgtttcag ttagcctccc ccatctcccc tattcctttg ccctcggacg agtgctgggg
     cgtcggtttc cactatcggc gagtacttct acacagccat cggtccagac ggccgcgctt
     ctgcgggcga tttgtgtacg cccgacagtc ccggctccgg atcggacgat tgcgtcgcat
     cgaccctgcg cccaagctgc atcatcgaaa ttgccgtcaa ccaagctctg atagagttgg
     tcaagaccaa tgcggagcat atacgcccgg agccgcggcg atcctgcaag ctccggatgc
     ctccgctcga agtagcgcgt ctgctgctcc atacaagcca accacggcct ccagaagaag
     atgttggcga cctcgtattg ggaatccccg aacatcgcct cgctccagtc aatgaccgct
     gttatgcggc cattgtccgt caggacattg ttggagccga aatccgcgtg cacgaggtgc
     cggacttcgg ggcagtcctc ggcccaaagc atcagctcat cgagagcctg cgcgacggac
     gcactgacgg tgtcgtccat cacagtttgc cagtgataca catggggatc agcaatcgcg
     catatgaaat cacgccatgt agtgtattga ccgattcctt gcggtccgaa tgggccgaac
     ccgctcgtct ggctaagatc ggccgcagcg atcgcatcca tggcctccgc gaccggctgc
     agaacagcgg gcagttcggt ttcaggcagg tcttgcaacg tgacaccctg tgcacggcgg
     gagatgcaat aggtcaggct ctcgctgaat tccccaatgt caagcacttc cggaatcggg
     agcgcggccg atgcaaagtg ccgataaaca taacgatctt tgtagaaacc atcggcgcag
     ctatttaccc gcaggacata tccacgccct cctacatcga agctgaaagc acgagattct
     tcgccctccg agagctgcat caggtcggag acgctgtcga acttttcgat cagaaacttc
     tcgacagacg tcgcggtgag ttcaggcttt ttcatatctc attgcccggg atctgcggca
     cgctgttgac gctgttaagc gggtcgctgc agggtcgctc ggtgttcgag gccacacgcg
     tcaccttaat atgcgaagtg gacctgggac cgcgccgccc cgactgcatc tgcgtgttcg
     aattcgccaa tgacaagacg ctgggcgggg tttgtgtcat catagaacta aagacatgca
     aatatatttc ttccggggac accgccagca aacgcgagca acgggccacg gggatgaagc
     agggcatggc ggccgacgcg ctgggctacg tcttgctggc gttcgcgacg cgaggctgga
     tggccttccc cattatgatt cttctcgctt ccggcggcat cgggatgccc gcgttgcagg
     ccatgctgtc caggcaggta gatgacgacc atcagggaca gcttcaagga tcgctcgcgg
     ctcttaccag cctaacttcg atcactggac cgctgatcgt cacggcgatt tatgccgcct
     cggcgagcac atggaacggg ttggcatgga ttgtaggcgc cgccctatac cttgtctgcc
     tccccgcgtt gcgtcgcggt gcatggagcc gggccacctc gacctgaatg gaagccggcg
     gcacctcgct aacggattca ccactccaag aattggagcc aatcaattct tgcggagaac
     tgtgaatgcg caaaccaacc cttggcagaa catatccatc gcgtccgcca tctccagcag
     ccgcacgcgg cgcagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc
     cataggctcc gcccccctga cgagcatcac aaaaatcgac gctcaagtca gaggtggcga
     aacccgacag gactataaag ataccaggcg tttccccctg gaagctccct cgtgcgctct
     cctgttccga ccctgccgct taccggatac ctgtccgcct ttctcccttc gggaagcgtg
     gcgctttctc atagctcacg ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag
     ctgggctgtg tgcacgaacc ccccgttcag cccgaccgct gcgccttatc cggtaactat
     cgtcttgagt ccaacccggt aagacacgac ttatcgccac tggcagcagc cactggtaac
     aggattagca gagcgaggta tgtaggcggt gctacagagt tcttgaagtg gtggcctaac
     tacggctaca ctagaaggac agtatttggt atctgcgctc tgctgaagcc agttaccttc
     ggaaaaagag ttggtagctc ttgatccggc aaacaaacca ccgctggtag cggtggtttt
     tttgtttgca agcagcagat tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc
     ttttctacgg ggtctgacgc tcagtggaac gaaaactcac gttacttcct ccgtgtggcc
     gaacacgtcg agccatgttg tgcaaaaaag cggttagctc cttcggtcct ccgatcgttg
     tcagaagtaa gttggccgca gtgttatcac tcatggttat ggcagcactg cataattctc
     ttactgtcat gccatccgta agatgctttt ctgtgactgg tgagtactca accaagtcat
     tctgagaata gtgtatgcgg cgaccgagtt gctcttgccc ggcgtcaaca cgggataata
     ccgcgccaca tagcagaact ttaaaagtgc tcatcattgg aaaacgttct tcggggcgaa
     aactctcaag gatcttaccg ctgttgagat ccagttcgat gtaacccact cgtgcaccca
     actgatcttc agcatctttt actttcacca gcgtttctgg gtgagcaaaa acaggaaggc
     aaaatgccgc aaaaaaggga ataagggcga cacggaaatg ttgaatactc atactcttcc
     tttttcaata ttattgaagc atttatcagg gttattgtct catgagcgga tacatatttg
     aatgtattta gaaaaataaa caaatagggg ttccgcgcac atttccccga aaagtgccac
     ctgacgtcta agaaaccatt attatcatga cattaaccta taaaaatagg cgtatcacga
     ggccctttcg tcttcaagaa ttctcatgtt tgacagctta tcatcgataa gctgatcctc
     acaggccgca cccagctttt cttccgttgc cccagtagca tctctgtctg gtgaccttga
     agaggaagag gaggggtccc gagaatcccc atccctaccg tccagcaaaa agggggacga
     ggaatttgag gcctggcttg aggctcagga cgcaaatctt gaggatgttc agcgggagtt
     ttccgggctg cgagtaattg gtgatgagga cgaggatggt tcggaggatg gggaattttc
     agacctggat ctgtctgaca gcgaccatga aggggatgag ggtggggggg ctgttggagg
     gggcaggagt ctgcactccc tgtattcact gagcgtcgtc taataaagat gtctattgat
     ctcttttagt gtgaatcatg tctgacgagg ggccaggtac aggacctgga aatggcctag
     gagagaaggg agacacatct ggaccagaag gctccggcgg cagtggacct caaagaagag
     ggggtgataa ccatggacga ggacggggaa gaggacgagg acgaggaggc ggaagaccag
     gagccccggg cggctcagga tcagggccaa gacatagaga tggtgtccgg agaccccaaa
     aacgtccaag ttgcattggc tgcaaaggga cccacggtgg aacaggagca ggagcaggag
     cgggaggggc aggagcagga ggggcaggag ggaggccggg gtcgaggagg tagtggaggc
     cggggtcgag gaggtagtgg aggccgccgg ggtagaggac gtgaaagagc caggggggga
     agtcgtgaaa gagccagggg gagaggtcgt ggacgtggag aaaagaggcc caggagtccc
     agtagtcagt catcatcatc cgggtctcca ccgcgcaggc cccctccagg tagaaggcca
     tttttccacc ctgtagggga agccgattat tttgaatacc accaagaagg tggcccagat
     ggtgagcctg acgtgccccc gggagcgata gagcagggcc ccgcagatga cccaggagaa
     ggcccaagca ctggaccccg gggtcagggt gatggaggca ggcgcaaaaa aggagggtgg
     tttggaaagc atcgtggtca aggaggttcc aacccgaaat ttgagaacat tgcagaaggt
     ttaagagctc tcctggctag gagtcacgta gaaaggacta ccgacgaagg aacttgggtc
     gccggtgtgt tcgtatatgg aggtagtaag acctcccttt acaacctaag gcgaggaact
     gcccttgcta ttccacaatg tcgtcttaca ccattgagtc gtctcccctt tggaatggcc
     cctggacccg gcccacaacc tggcccgcta agggagtcca ttgtctgtta tttcatggtc
     tttttacaaa ctcatatatt tgctgaggtt ttgaaggatg cgattaagga ccttgttatg
     acaaagcccg ctcctacctg caatatcagg gtgactgtgt gcagctttga cgatggagta
     gatttgcctc cctggtttcc acctatggtg gaaggggctg ccgcggaggg tgatgacgga
     gatgacggag atgaaggagg tgatggagat gagggtgagg aagggcagga gtgatgtaac
     ttgttaggag acgccctcaa tcgtattaaa agccgtgtat tcccccgcac taaagaataa
     atccccagta gacatcatgc gtgctgttgg tgtatttctg gccatctgtc ttgtcaccat
     tttcgtcctc ccaacatggg gcaattgggc atacccatgt tgtcacgtca ctcagctccg
     cgctcaacac cttctcgcgt tggaaaacat tagcgacatt tacctggtga gcaatcagac
     atgcgacggc tttagcctgg cctccttaaa ttcacctaag aatgggagca accagcatgc
     aggaaaagga caagcagcga aaattcacgc ccccttggga ggtggcggca tatgcaaagg
     atagcactcc cactctacta ctgggtatca tatgctgact gtatatgcat gaggatagca
     tatgctaccc ggatacagat taggatagca tatactaccc agatatagat taggatagca
     tatgctaccc agatatagat taggatagcc tatgctaccc agatataaat taggatagca
     tatactaccc agatatagat taggatagca tatgctaccc agatatagat taggatagcc
     tatgctaccc agatatagat taggatagca tatgctaccc agatatagat taggatagca
     tatgctatcc agatatttgg gtagtatatg ctacccagat ataaattagg atagcatata
     ctaccctaat ctctattagg atagcatatg ctacccggat acagattagg atagcatata
     ctacccagat atagattagg atagcatatg ctacccagat atagattagg atagcctatg
     ctacccagat ataaattagg atagcatata ctacccagat atagattagg atagcatatg
     ctacccagat atagattagg atagcctatg ctacccagat atagattagg atagcatatg
     ctatccagat atttgggtag tatatgctac ccatggcaac attagcccac cgtgctctca
     gcgacctcgt gaatatgagg accaacaacc ctgtgcttgg cgctcaggcg caagtgtgtg
     taatttgtcc tccagatcgc agcaatcgcg cccctatctt ggcccgccca cctacttatg
     caggtattcc ccggggtgcc attagtggtt ttgtgggcaa gtggtttgac cgcagtggtt
     agcggggtta caatcagcca agttattaca cccttatttt acagtccaaa accgcagggc
     ggcgtgtggg ggctgacgcg tgcccccact ccacaatttc aaaaaaaaga gtggccactt
     gtctttgttt atgggcccca ttggcgtgga gccccgttta attttcgggg gtgttagaga
     caaccagtgg agtccgctgc tgtcggcgtc cactctcttt ccccttgtta caaatagagt
     gtaacaacat ggttcacctg tcttggtccc tgcctgggac acatcttaat aaccccagta
     tcatattgca ctaggattat gtgttgccca tagccataaa ttcgtgtgag atggacatcc
     agtctttacg gcttgtcccc accccatgga tttctattgt taaagatatt cagaatgttt
     cattcctaca ctagtattta ttgcccaagg ggtttgtgag ggttatattg gtgtcatagc
     acaatgccac cactgaaccc cccgtccaaa ttttattctg ggggcgtcac ctgaaacctt
     gttttcgagc acctcacata caccttactg ttcacaactc agcagttatt ctattagcta
     aacgaaggag aatgaagaag caggcgaaga ttcaggagag ttcactgccc gctccttgat
     cttcagccac tgcccttgtg actaaaatgg ttcactaccc tcgtggaatc ctgaccccat
     gtaaataaaa ccgtgacagc tcatggggtg ggagatatcg ctgttcctta ggaccctttt
     actaacccta attcgatagc atatgcttcc cgttgggtaa catatgctat tgaattaggg
     ttagtctgga tagtatatac tactacccgg gaagcatatg ctacccgttt agggttaaca
     agggggcctt ataaacacta ttgctaatgc cctcttgagg gtccgcttat cggtagctac
     acaggcccct ctgattgacg ttggtgtagc ctcccgtagt cttcctgggc ccctgggagg
     tacatgtccc ccagcattgg tgtaagagct tcagccaaga gttacacata aaggcaatgt
     tgtgttgcag tccacagact gcaaagtctg ctccaggatg aaagccactc agtgttggca
     aatgtgcaca tccatttata aggatgtcaa ctacagtcag agaacccctt tgtgtttggt
     ccccccccgt gtcacatgtg gaacagggcc cagttggcaa gttgtaccaa ccaactgaag
     ggattacatg cactgccccg aatacaaaac aaaagcgctc ctcgtaccag cgaagaaggg
     gcagagatgc cgtagtcagg tttagttcgt ccggcggcgg ggc
//