back Return to this vector's summary.
ID   PREP5      preliminary; circular DNA; SYN; 10188 BP.
XX
AC   IG9946;
XX
DT   01-JUL-1995 (Rel. 11, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pREP5 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pcDV1/S2 from pcDV1 & linker
RC   pRSVCAT/H2 from pRSVcat & linker
RC   [pBT from BT gene]
RC   pRSV/BT from pRSVCAT/H2 & pBT
RC   pRSVPA1 from pRSV/BT & pcDV1/S2
RC   pRSVPA2 from pRSVPA1 & linker
RC   p220.2 from p201
RC   p220.2/B- from p220.2
RC   pREP2 from pRSVPA2 & p220.2/B-
RC   pREP3 from pREP2
RC   p220.2/XS from p220.2/B-
RC   pHS1PA4 from pRSVPA2
RC   pMEP4 from p220.2/XS & pHS1PA4
RC   pRSVCAT-B2 from pRSVcat & linker
RC   pRSVCAT-B2K from pRSVCAT-B2 & linker
RC   pREP4 from pRSVCAT-B2K & pMEP4
RC   pREP5 from pREP4 & oligo
RA   Groger R.K., Morrow D.M., Tykocinski M.L.;
RT   "Directional antisense and sense cDNA cloning using Epstein-Barr
RT   virus episomal expression vectors";
RL   Gene 81:285-294(1989).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   NM (pREP5)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli NM522)(E.coli INValphaF')(mammal)
CC   CP ()
CC   FN (expression)
CC   SE ()
CC   PA (pREP4)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pREP4 KpnI-BamHI 10128bp 462..10183..407
FT                   2. oligo
FT                   BamHI-NaeI-StuI-XhoI-NotI-NheI-HindIII-PvuII-KpnI 60bp
FT                   \ gatcggtaccagctgaagcttgctagcggccgctcgaggccggcaaggcc
FT                   \ ggatccgtac
FT                   -> pREP5 10188bp"
FT   -               1..10128
FT                   /note="pREP4 462..10183..406 10128bp
FT                   BamHI = G^GATCC
FT                   \         gatcg..."
FT   -               10129..10188
FT                   /note="60bp
FT                   \ gatcggtaccagctgaagcttgctagcggccgctcgaggccggcaaggcc
FT                   \ ggatccgtac
FT                   \            ...ccgtac
FT                   KpnI = Asp718I = GGTAC^C"
FT   misc_binding    0..0
FT                   /note="SIT XbaI"
FT   polyA_signal    0..0
FT                   /note="PLA SV40 early gene"
FT   misc_binding    0..0
FT                   /note="MCS
FT                   KpnI-PvuII-NheI-HindIII-NheI-NotI-XhoI-SfiI-BamHI"
FT   promoter        complement(0..0)
FT                   /note="PRO Rous sarcoma virus (RSV) long terminal
FT                   repeat (LTR)"
FT   polyA_signal    0..0
FT                   /note="PLA SV40 thymidine kinase (TK) gene"
FT   CDS             complement(0..0)
FT                   /note="ANT E. coli hygromycin phosphotransferase gene;
FT                   hygromycin resistance gene (hyg)"
FT   promoter        complement(0..0)
FT                   /note="PRO SV40 thymidine kinase (TK) gene"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             complement(0..0)
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   CDS             0..0
FT                   /note="GEN Epstein-Barr virus nuclear antigen gene
FT                   (EBNA-1)"
FT   rep_origin      0..0
FT                   /note="ORI Epstein-Barr virus (EBV) oriP"
XX
SQ   Sequence 10188 BP; 2498 A; 2548 C; 2911 G; 2231 T; 0 other;
     ccagcttgga ggtgcacacc aatgtggtga atggtcaaat ggcgtttatt gtatcgagct
     aggcacttaa atacaattat ctctgcaatg cggaattcag tggttcgtcc aatccatgtc
     agacctgtct gttgccttcc taataaggca cgatcgtacc accttacttc caccaatcgg
     catgcacggt gctttttctc tccttgtaag gcatgttgct aactcatcgt taccatgttg
     caagactaca agtgtattgc ataagactac atttccccct ccctatgcaa aagcgaaact
     actatatcct gaggggactc ctaaccgcgt acaaccgaag ccccgctggg cgcctaaaca
     caccctagtc ccctcagata cgcgtatatc tggcccgtac atcgcgaagc agcgcaaaac
     gcctaaccct aagcagattc ttcatgcaat tgtcggtcaa gccttgcctt gttgtagctt
     aaattttgct cgcgcactac tcagcgacct ccaacacaca agcagggagc agatactggc
     ttaactatgc ggcagcagag cagattgtac tgagagtgca ccatacaagc tcaggatctg
     cgatgataag ctgtcaaaca tgagaattgg tcgaccactg ggcgccagaa atccgcgcgg
     tggtttttgg gggtcggggg tgtttggcag ccacagacgc ccggtgttcg tgtcgcgcca
     gtacatgcgg tccatgccca ggccatccaa aaaccatggg tctgtctgct cagtccagtc
     gtggaccaga ccccacgcaa cgcccaaaat aataaccccc acgaaccata aaccattccc
     catgggggac cccgtcccta acccacgggg ccagtggcta tggcagggcc tgccgccccg
     acgttggctg cgagccctgg gccttcaccc gaacttgggg ggtggggtgg ggaaaaggaa
     gaaacgcggg cgtattggcc ccaatggggt ctcggtgggg tatcgacaga gtgccagccc
     tgggaccgaa ccccgcgttt atgaacaaac gacccaacac ccgtgcgttt tattctgtct
     ttttattgcc gtcatagcgc gggttccttc cggtattgtc tccttccgtg tttcagttag
     cctcccccat ctcccctatt cctttgccct cggacgagtg ctggggcgtc ggtttccact
     atcggcgagt acttctacac agccatcggt ccagacggcc gcgcttctgc gggcgatttg
     tgtacgcccg acagtcccgg ctccggatcg gacgattgcg tcgcatcgac cctgcgccca
     agctgcatca tcgaaattgc cgtcaaccaa gctctgatag agttggtcaa gaccaatgcg
     gagcatatac gcccggagcc gcggcgatcc tgcaagctcc ggatgcctcc gctcgaagta
     gcgcgtctgc tgctccatac aagccaacca cggcctccag aagaagatgt tggcgacctc
     gtattgggaa tccccgaaca tcgcctcgct ccagtcaatg accgctgtta tgcggccatt
     gtccgtcagg acattgttgg agccgaaatc cgcgtgcacg aggtgccgga cttcggggca
     gtcctcggcc caaagcatca gctcatcgag agcctgcgcg acggacgcac tgacggtgtc
     gtccatcaca gtttgccagt gatacacatg gggatcagca atcgcgcata tgaaatcacg
     ccatgtagtg tattgaccga ttccttgcgg tccgaatggg ccgaacccgc tcgtctggct
     aagatcggcc gcagcgatcg catccatggc ctccgcgacc ggctgcagaa cagcgggcag
     ttcggtttca ggcaggtctt gcaacgtgac accctgtgca cggcgggaga tgcaataggt
     caggctctcg ctgaattccc caatgtcaag cacttccgga atcgggagcg cggccgatgc
     aaagtgccga taaacataac gatctttgta gaaaccatcg gcgcagctat ttacccgcag
     gacatatcca cgccctccta catcgaagct gaaagcacga gattcttcgc cctccgagag
     ctgcatcagg tcggagacgc tgtcgaactt ttcgatcaga aacttctcga cagacgtcgc
     ggtgagttca ggctttttca tatctcattg cccgggatct gcggcacgct gttgacgctg
     ttaagcgggt cgctgcaggg tcgctcggtg ttcgaggcca cacgcgtcac cttaatatgc
     gaagtggacc tgggaccgcg ccgccccgac tgcatctgcg tgttcgaatt cgccaatgac
     aagacgctgg gcggggtttg tgtcatcata gaactaaaga catgcaaata tatttcttcc
     ggggacaccg ccagcaaacg cgagcaacgg gccacgggga tgaagcaggg catggcggcc
     gacgcgctgg gctacgtctt gctggcgttc gcgacgcgag gctggatggc cttccccatt
     atgattcttc tcgcttccgg cggcatcggg atgcccgcgt tgcaggccat gctgtccagg
     caggtagatg acgaccatca gggacagctt caaggatcgc tcgcggctct taccagccta
     acttcgatca ctggaccgct gatcgtcacg gcgatttatg ccgcctcggc gagcacatgg
     aacgggttgg catggattgt aggcgccgcc ctataccttg tctgcctccc cgcgttgcgt
     cgcggtgcat ggagccgggc cacctcgacc tgaatggaag ccggcggcac ctcgctaacg
     gattcaccac tccaagaatt ggagccaatc aattcttgcg gagaactgtg aatgcgcaaa
     ccaacccttg gcagaacata tccatcgcgt ccgccatctc cagcagccgc acgcggcgca
     gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg tttttccata ggctccgccc
     ccctgacgag catcacaaaa atcgacgctc aagtcagagg tggcgaaacc cgacaggact
     ataaagatac caggcgtttc cccctggaag ctccctcgtg cgctctcctg ttccgaccct
     gccgcttacc ggatacctgt ccgcctttct cccttcggga agcgtggcgc tttctcatag
     ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca
     cgaacccccc gttcagcccg accgctgcgc cttatccggt aactatcgtc ttgagtccaa
     cccggtaaga cacgacttat cgccactggc agcagccact ggtaacagga ttagcagagc
     gaggtatgta ggcggtgcta cagagttctt gaagtggtgg cctaactacg gctacactag
     aaggacagta tttggtatct gcgctctgct gaagccagtt accttcggaa aaagagttgg
     tagctcttga tccggcaaac aaaccaccgc tggtagcggt ggtttttttg tttgcaagca
     gcagattacg cgcagaaaaa aaggatctca agaagatcct ttgatctttt ctacggggtc
     tgacgctcag tggaacgaaa actcacgtta agggattttg gtcatgagat tatcaaaaag
     gatcttcacc tagatccttt taaattaaaa atgaagtttt aaatcaatct aaagtatata
     tgagtaaact tggtctgaca gttaccaatg cttaatcagt gaggcaccta tctcagcgat
     ctgtctattt cgttcatcca tagttgcctg actccccgtc gtgtagataa ctacgatacg
     ggagggctta ccatctggcc ccagtgctgc aatgataccg cgagacccac gctcaccggc
     tccagattta tcagcaataa accagccagc cggaagggcc gagcgcagaa gtggtcctgc
     aactttatcc gcctccatcc agtctattaa ttgttgccgg gaagctagag taagtagttc
     gccagttaat agtttgcgca acgttgttgc cattgctgca ggcatcgtgg tgtcacgctc
     gtcgtttggt atggcttcat tcagctccgg ttcccaacga tcaaggcgag ttacatgatc
     ccccatgttg tgcaaaaaag cggttagctc cttcggtcct ccgatcgttg tcagaagtaa
     gttggccgca gtgttatcac tcatggttat ggcagcactg cataattctc ttactgtcat
     gccatccgta agatgctttt ctgtgactgg tgagtactca accaagtcat tctgagaata
     gtgtatgcgg cgaccgagtt gctcttgccc ggcgtcaaca cgggataata ccgcgccaca
     tagcagaact ttaaaagtgc tcatcattgg aaaacgttct tcggggcgaa aactctcaag
     gatcttaccg ctgttgagat ccagttcgat gtaacccact cgtgcaccca actgatcttc
     agcatctttt actttcacca gcgtttctgg gtgagcaaaa acaggaaggc aaaatgccgc
     aaaaaaggga ataagggcga cacggaaatg ttgaatactc atactcttcc tttttcaata
     ttattgaagc atttatcagg gttattgtct catgagcgga tacatatttg aatgtattta
     gaaaaataaa caaatagggg ttccgcgcac atttccccga aaagtgccac ctgacgtcta
     agaaaccatt attatcatga cattaaccta taaaaatagg cgtatcacga ggccctttcg
     tcttcaagaa ttctcatgtt tgacagctta tcatcgataa gctgatcctc acaggccgca
     cccagctttt cttccgttgc cccagtagca tctctgtctg gtgaccttga agaggaagag
     gaggggtccc gagaatcccc atccctaccg tccagcaaaa agggggacga ggaatttgag
     gcctggcttg aggctcagga cgcaaatctt gaggatgttc agcgggagtt ttccgggctg
     cgagtaattg gtgatgagga cgaggatggt tcggaggatg gggaattttc agacctggat
     ctgtctgaca gcgaccatga aggggatgag ggtggggggg ctgttggagg gggcaggagt
     ctgcactccc tgtattcact gagcgtcgtc taataaagat gtctattgat ctcttttagt
     gtgaatcatg tctgacgagg ggccaggtac aggacctgga aatggcctag gagagaaggg
     agacacatct ggaccagaag gctccggcgg cagtggacct caaagaagag ggggtgataa
     ccatggacga ggacggggaa gaggacgagg acgaggaggc ggaagaccag gagccccggg
     cggctcagga tcagggccaa gacatagaga tggtgtccgg agaccccaaa aacgtccaag
     ttgcattggc tgcaaaggga cccacggtgg aacaggagca ggagcaggag cgggaggggc
     aggagcagga ggggcaggag caggaggagg ggcaggagca ggaggagggg caggaggggc
     aggaggggca ggaggggcag gagcaggagg aggggcagga gcaggaggag gggcaggagg
     ggcaggaggg gcaggagcag gaggaggggc aggagcagga ggaggggcag gaggggcagg
     agcaggagga ggggcaggag gggcaggagg ggcaggagca ggaggagggg caggagcagg
     aggaggggca ggaggggcag gagcaggagg aggggcagga ggggcaggag gggcaggagc
     aggaggaggg gcaggagcag gaggggcagg aggggcagga ggggcaggag caggaggggc
     aggagcagga ggaggggcag gaggggcagg aggggcagga gcaggagggg caggagcagg
     aggggcagga gcaggagggg caggagcagg aggggcagga ggggcaggag caggaggggc
     aggaggggca ggagcaggag gggcaggagg ggcaggagca ggaggagggg caggaggggc
     aggagcagga ggaggggcag gaggggcagg agcaggaggg gcaggagggg caggagcagg
     aggggcagga ggggcaggag caggaggggc aggaggggca ggagcaggag gaggggcagg
     agcaggaggg gcaggagcag gaggtggagg ccggggtcga ggaggcagtg gaggccgggg
     tcgaggaggt agtggaggcc ggggtcgagg aggtagtgga ggccgccggg gtagaggacg
     tgaaagagcc agggggggaa gtcgtgaaag agccaggggg agaggtcgtg gacgtggaga
     aaagaggccc aggagtccca gtagtcagtc atcatcatcc gggtctccac cgcgcaggcc
     ccctccaggt agaaggccat ttttccaccc tgtaggggaa gccgattatt ttgaatacca
     ccaagaaggt ggcccagatg gtgagcctga cgtgcccccg ggagcgatag agcagggccc
     cgcagatgac ccaggagaag gcccaagcac tggaccccgg ggtcagggtg atggaggcag
     gcgcaaaaaa ggagggtggt ttggaaagca tcgtggtcaa ggaggttcca acccgaaatt
     tgagaacatt gcagaaggtt taagagctct cctggctagg agtcacgtag aaaggactac
     cgacgaagga acttgggtcg ccggtgtgtt cgtatatgga ggtagtaaga cctcccttta
     caacctaagg cgaggaactg cccttgctat tccacaatgt cgtcttacac cattgagtcg
     tctccccttt ggaatggccc ctggacccgg cccacaacct ggcccgctaa gggagtccat
     tgtctgttat ttcatggtct ttttacaaac tcatatattt gctgaggttt tgaaggatgc
     gattaaggac cttgttatga caaagcccgc tcctacctgc aatatcaggg tgactgtgtg
     cagctttgac gatggagtag atttgcctcc ctggtttcca cctatggtgg aaggggctgc
     cgcggagggt gatgacggag atgacggaga tgaaggaggt gatggagatg agggtgagga
     agggcaggag tgatgtaact tgttaggaga cgccctcaat cgtattaaaa gccgtgtatt
     cccccgcact aaagaataaa tccccagtag acatcatgcg tgctgttggt gtatttctgg
     ccatctgtct tgtcaccatt ttcgtcctcc caacatgggg caattgggca tacccatgtt
     gtcacgtcac tcagctccgc gctcaacacc ttctcgcgtt ggaaaacatt agcgacattt
     acctggtgag caatcagaca tgcgacggct ttagcctggc ctccttaaat tcacctaaga
     atgggagcaa ccagcatgca ggaaaaggac aagcagcgaa aattcacgcc cccttgggag
     gtggcggcat atgcaaagga tagcactccc actctactac tgggtatcat atgctgactg
     tatatgcatg aggatagcat atgctacccg gatacagatt aggatagcat atactaccca
     gatatagatt aggatagcat atgctaccca gatatagatt aggatagcct atgctaccca
     gatataaatt aggatagcat atactaccca gatatagatt aggatagcat atgctaccca
     gatatagatt aggatagcct atgctaccca gatatagatt aggatagcat atgctaccca
     gatatagatt aggatagcat atgctatcca gatatttggg tagtatatgc tacccagata
     taaattagga tagcatatac taccctaatc tctattagga tagcatatgc tacccggata
     cagattagga tagcatatac tacccagata tagattagga tagcatatgc tacccagata
     tagattagga tagcctatgc tacccagata taaattagga tagcatatac tacccagata
     tagattagga tagcatatgc tacccagata tagattagga tagcctatgc tacccagata
     tagattagga tagcatatgc tatccagata tttgggtagt atatgctacc catggcaaca
     ttagcccacc gtgctctcag cgacctcgtg aatatgagga ccaacaaccc tgtgcttggc
     gctcaggcgc aagtgtgtgt aatttgtcct ccagatcgca gcaatcgcgc ccctatcttg
     gcccgcccac ctacttatgc aggtattccc cggggtgcca ttagtggttt tgtgggcaag
     tggtttgacc gcagtggtta gcggggttac aatcagccaa gttattacac ccttatttta
     cagtccaaaa ccgcagggcg gcgtgtgggg gctgacgcgt gcccccactc cacaatttca
     aaaaaaagag tggccacttg tctttgttta tgggccccat tggcgtggag ccccgtttaa
     ttttcggggg tgttagagac aaccagtgga gtccgctgct gtcggcgtcc actctctttc
     cccttgttac aaatagagtg taacaacatg gttcacctgt cttggtccct gcctgggaca
     catcttaata accccagtat catattgcac taggattatg tgttgcccat agccataaat
     tcgtgtgaga tggacatcca gtctttacgg cttgtcccca ccccatggat ttctattgtt
     aaagatattc agaatgtttc attcctacac tagtatttat tgcccaaggg gtttgtgagg
     gttatattgg tgtcatagca caatgccacc actgaacccc ccgtccaaat tttattctgg
     gggcgtcacc tgaaaccttg ttttcgagca cctcacatac accttactgt tcacaactca
     gcagttattc tattagctaa acgaaggaga atgaagaagc aggcgaagat tcaggagagt
     tcactgcccg ctccttgatc ttcagccact gcccttgtga ctaaaatggt tcactaccct
     cgtggaatcc tgaccccatg taaataaaac cgtgacagct catggggtgg gagatatcgc
     tgttccttag gaccctttta ctaaccctaa ttcgatagca tatgcttccc gttgggtaac
     atatgctatt gaattagggt tagtctggat agtatatact actacccggg aagcatatgc
     tacccgttta gggttaacaa gggggcctta taaacactat tgctaatgcc ctcttgaggg
     tccgcttatc ggtagctaca caggcccctc tgattgacgt tggtgtagcc tcccgtagtc
     ttcctgggcc cctgggaggt acatgtcccc cagcattggt gtaagagctt cagccaagag
     ttacacataa aggcaatgtt gtgttgcagt ccacagactg caaagtctgc tccaggatga
     aagccactca gtgttggcaa atgtgcacat ccatttataa ggatgtcaac tacagtcaga
     gaaccccttt gtgtttggtc cccccccgtg tcacatgtgg aacagggccc agttggcaag
     ttgtaccaac caactgaagg gattacatgc actgccccga atacaaaaca aaagcgctcc
     tcgtaccagc gaagaagggg cagagatgcc gtagtcaggt ttagttcgtc cggcggcggg
     gctctagagt cgaccggtca tggctgcgcc ccgacacccg ccaacacccg ctgacgcgcc
     ctgacgggct tgtctgctcc cggcatccgc ttacagacaa gctgtgaccg tctccgggag
     ctgcatgtgt cagaggtttt caccgtcatc accgaaacgc gcgaggcagc cggatcataa
     tcagccatac cacatttgta gaggttttac ttgctttaaa aaacctcccc acctccccct
     gaacctgaaa cataaaatga atgcaattgt tgttgttaac ttgtttattg cagcttataa
     tggttacaaa taaagcaata gcatcacaaa tttcacaaat aaagcatttt tttcactgca
     ttctagttgt ggtttgtcca aactcatcaa tgtatcttat catgtctgga tcggtaccag
     ctgaagcttg ctagcggccg ctcgaggccg gcaaggccgg atccgtac
//