back Return to this vector's summary.
ID   PREP7      preliminary; circular DNA; SYN; 9494 BP.
XX
AC   IG1107; K01383;
XX
DT   01-FEB-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pREP7 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pcDV1/S2 from pcDV1 & linker
RC   pRSVCAT/H2 from pRSVcat & linker
RC   [pBT from BT gene]
RC   pRSV/BT from pRSVCAT/H2 & pBT
RC   pRSVPA1 from pRSV/BT & pcDV1/S2
RC   pRSVPA2 from pRSVPA1 & linker
RC   p220.2 from p201
RC   p220.2/B- from p220.2
RC   pREP2 from pRSVPA2 & p220.2/B-
RC   pREP3 from pREP2
RC   p220.2/XS from p220.2/B-
RC   pHS1PA4 from pRSVPA2
RC   pMEP4 from p220.2/XS & pHS1PA4
RC   pRSVCAT-B2 from pRSVcat & linker
RC   pRSVCAT-B2K from pRSVCAT-B2 & linker
RC   pREP4 from pRSVCAT-B2K & pMEP4
RC   pREP5 from pREP4 & oligo
RA   Groger R.K., Morrow D.M., Tykocinski M.L.;
RT   "Directional antisense and sense cDNA cloning using Epstein-Barr
RT   virus episomal expression vectors";
RL   Gene 81:285-294(1989).
XX
CC   NM (pREP7)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (Invitrogen)
CC   HO (E.coli NM522)(E.coli INValphaF')(mammal)
CC   CP ()
CC   FN (expression)
CC   SE ()
CC   PA (EBV)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pREP4 KpnI-BamHI 10128bp 462..10183..407
FT                   2. oligo
FT                   BamHI-NaeI-StuI-XhoI-NotI-NheI-HindIII-PvuII-KpnI 60bp
FT                   \ gatcggtaccagctgaagcttgctagcggccgctcgaggccggcaaggcc
FT                   \ ggatccgtac
FT                   -> pREP5 10188bp
FT                   1. pREP5 remove, 10188bp-
FT                   -> pREP7 9494bp"
FT   misc_binding    1..1
FT                   /note="SIT XbaI"
FT   promoter        0..0
FT                   /note="PRO Rous sarcoma virus (RSV) long terminal
FT                   repeat (LTR)"
FT   misc_binding    0..0
FT                   /note="MCS
FT                   KpnI-PvuII-NheI-HindIII-NheI-NotI-XhoI-SfiI-BamHI"
FT   polyA_signal    0..0
FT                   /note="PLA SV40 early gene"
FT   polyA_signal    0..0
FT                   /note="PLA SV40 thymidine kinase (TK) gene"
FT   CDS             complement(0..0)
FT                   /note="ANT E. coli hygromycin phosphotransferase gene;
FT                   hygromycin resistance gene (hyg)"
FT   promoter        complement(0..0)
FT                   /note="PRO SV40 thymidine kinase (TK) gene"
FT   misc_binding    2749..2749
FT                   /note="SIT BstBI"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             complement(0..0)
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   misc_binding    5259..5259
FT                   /note="SIT ClaI"
FT   misc_binding    5405..5405
FT                   /note="SIT StuI"
FT   CDS             0..0
FT                   /note="GEN Epstein-Barr virus nuclear antigen gene
FT                   (EBNA-1)"
FT   misc_binding    6421..6421
FT                   /note="SIT SacI"
FT   rep_origin      0..0
FT                   /note="ORI Epstein-Barr virus (EBV) oriP"
FT   misc_binding    8850..8850
FT                   /note="SIT EcoRV"
XX
SQ   Sequence 9494 BP; 2318 A; 2394 C; 2551 G; 2231 T; 0 other;
     tctagagtcg accaattctc atgtttgaca gcttatcatc gcagatcctg agcttgtatg
     gtgcactctc agtacaatct gctctgctgc cgcatagtta agccagtatc tgctccctgc
     ttgtgtgttg gaggtcgctg agtagtgcgc gagcaaaatt taagctacaa caaggcaagg
     cttgaccgac aattgcatga agaatctgct tagggttagg cgttttgcgc tgcttcgcga
     tgtacgggcc agatatacgc gtatctgagg ggactagggt gtgtttaggc gcccagcggg
     gcttcggttg tacgcggtta ggagtcccct caggatatag tagtttcgct tttgcatagg
     gagggggaaa tgtagtctta tgcaatacac ttgtagtctt gcaacatggt aacgatgagt
     tagcaacatg ccttacaagg agagaaaaag caccgtgcat gccgattggt ggaagtaagg
     tggtacgatc gtgccttatt aggaaggcaa cagacaggtc tgacatggat tggacgaacc
     actgaattcc gcattgcaga gataattgta tttaagtgcc tagctcgata caataaacgc
     catttgacca ttcaccacat tggtgtgcac ctccaagctg ggtaccagct gctagcaagc
     ttgctagcgg ccgctcgagg ccggcaaggc cggatccaga catgataaga tacattgatg
     agtttggaca aaccacaact agaatgcagt gaaaaaaatg ctttatttgt gaaatttgtg
     atgctattgc tttatttgta accattataa gctgcaataa acaagttaac aacaacaatt
     gcattcattt tatgtttcag gttcaggggg aggtggggag gttttttaaa gcaagtaaaa
     cctctacaaa tgtggtatgg ctgattatga tccggctgcc tcgcgcgttt cggtgatgac
     ggtgaaaacc tctgacacat gcagctcccg gagacggtca cagcttgtct gtaagcggat
     gccgggagca gacaagcccg tcagggcgcg tcagcgggtg ttggcgggtg tcggggcgca
     gccatgaccg gtcgaccact gggcgccaga aatccgcgcg gtggtttttg ggggtcgggg
     gtgtttggca gccacagacg cccggtgttc gtgtcgcgcc agtacatgcg gtccatgccc
     aggccatcca aaaaccatgg gtctgtctgc tcagtccagt cgtggaccag accccacgca
     acgcccaaaa taataacccc cacgaaccat aaaccattcc ccatggggga ccccgtccct
     aacccacggg gccagtggct atggcagggc ctgccgcccc gacgttggct gcgagccctg
     ggccttcacc cgaacttggg gggtggggtg gggaaaagga agaaacgcgg gcgtattggc
     cccaatgggg tctcggtggg gtatcgacag agtgccagcc ctgggaccga accccgcgtt
     tatgaacaaa cgacccaaca cccgtgcgtt ttattctgtc tttttattgc cgtcatagcg
     cgggttcctt ccggtattgt ctccttccgt gtttcagtta gcctccccca tctcccctat
     tcctttgccc tcggacgagt gctggggcgt cggtttccac tatcggcgag tacttctaca
     cagccatcgg tccagacggc cgcgcttctg cgggcgattt gtgtacgccc gacagtcccg
     gctccggatc ggacgattgc gtcgcatcga ccctgcgccc aagctgcatc atcgaaattg
     ccgtcaacca agctctgata gagttggtca agaccaatgc ggagcatata cgcccggagc
     cgcggcgatc ctgcaagctc cggatgcctc cgctcgaagt agcgcgtctg ctgctccata
     caagccaacc acggcctcca gaagaagatg ttggcgacct cgtattggga atccccgaac
     atcgcctcgc tccagtcaat gaccgctgtt atgcggccat tgtccgtcag gacattgttg
     gagccgaaat ccgcgtgcac gaggtgccgg acttcggggc agtcctcggc ccaaagcatc
     agctcatcga gagcctgcgc gacggacgca ctgacggtgt cgtccatcac agtttgccag
     tgatacacat ggggatcagc aatcgcgcat atgaaatcac gccatgtagt gtattgaccg
     attccttgcg gtccgaatgg gccgaacccg ctcgtctggc taagatcggc cgcagcgatc
     gcatccatgg cctccgcgac cggctgcaga acagcgggca gttcggtttc aggcaggtct
     tgcaacgtga caccctgtgc acggcgggag atgcaatagg tcaggctctc gctgaattcc
     ccaatgtcaa gcacttccgg aatcgggagc gcggccgatg caaagtgccg ataaacataa
     cgatctttgt agaaaccatc ggcgcagcta tttacccgca ggacatatcc acgccctcct
     acatcgaagc tgaaagcacg agattcttcg ccctccgaga gctgcatcag gtcggagacg
     ctgtcgaact tttcgatcag aaacttctcg acagacgtcg cggtgagttc aggctttttc
     atatctcatt gcccgggatc tgcggcacgc tgttgacgct gttaagcggg tcgctgcagg
     gtcgctcggt gttcgaggcc acacgcgtca ccttaatatg cgaagtggac ctgggaccgc
     gccgccccga ctgcatctgc gtgttcgaat tcgccaatga caagacgctg ggcggggttt
     gtgtcatcat agaactaaag acatgcaaat atatttcttc cggggacacc gccagcaaac
     gcgagcaacg ggccacgggg atgaagcagg gcatggcggc cgacgcgctg ggctacgtct
     tgctggcgtt cgcgacgcga ggctggatgg ccttccccat tatgattctt ctcgcttccg
     gcggcatcgg gatgcccgcg ttgcaggcca tgctgtccag gcaggtagat gacgaccatc
     agggacagct tcaaggatcg ctcgcggctc ttaccagcct aacttcgatc actggaccgc
     tgatcgtcac ggcgatttat gccgcctcgg cgagcacatg gaacgggttg gcatggattg
     taggcgccgc cctatacctt gtctgcctcc ccgcgttgcg tcgcggtgca tggagccggg
     ccacctcgac ctgaatggaa gccggcggca cctcgctaac ggattcacca ctccaagaat
     tggagccaat caattcttgc ggagaactgt gaatgcgcaa accaaccctt ggcagaacat
     atccatcgcg tccgccatct ccagcagccg cacgcggcgc agcaaaaggc caggaaccgt
     aaaaaggccg cgttgctggc gtttttccat aggctccgcc cccctgacga gcatcacaaa
     aatcgacgct caagtcagag gtggcgaaac ccgacaggac tataaagata ccaggcgttt
     ccccctggaa gctccctcgt gcgctctcct gttccgaccc tgccgcttac cggatacctg
     tccgcctttc tcccttcggg aagcgtggcg ctttctcata gctcacgctg taggtatctc
     agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc
     gaccgctgcg ccttatccgg taactatcgt cttgagtcca acccggtaag acacgactta
     tcgccactgg cagcagccac tggtaacagg attagcagag cgaggtatgt aggcggtgct
     acagagttct tgaagtggtg gcctaactac ggctacacta gaaggacagt atttggtatc
     tgcgctctgc tgaagccagt taccttcgga aaaagagttg gtagctcttg atccggcaaa
     caaaccaccg ctggtagcgg tggttttttt gtttgcaagc agcagattac gcgcagaaaa
     aaaggatctc aagaagatcc tttgatcttt tctacggggt ctgacgctca gtggaacgaa
     aactcacgtt aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac ctagatcctt
     ttaaattaaa aatgaagttt taaatcaatc taaagtatat atgagtaaac ttggtctgac
     agttaccaat gcttaatcag tgaggcacct atctcagcga tctgtctatt tcgttcatcc
     atagttgcct gactccccgt cgtgtagata actacgatac gggagggctt accatctggc
     cccagtgctg caatgatacc gcgagaccca cgctcaccgg ctccagattt atcagcaata
     aaccagccag ccggaagggc cgagcgcaga agtggtcctg caactttatc cgcctccatc
     cagtctatta attgttgccg ggaagctaga gtaagtagtt cgccagttaa tagtttgcgc
     aacgttgttg ccattgctgc aggcatcgtg gtgtcacgct cgtcgtttgg tatggcttca
     ttcagctccg gttcccaacg atcaaggcga gttacatgat cccccatgtt gtgcaaaaaa
     gcggttagct ccttcggtcc tccgatcgtt gtcagaagta agttggccgc agtgttatca
     ctcatggtta tggcagcact gcataattct cttactgtca tgccatccgt aagatgcttt
     tctgtgactg gtgagtactc aaccaagtca ttctgagaat agtgtatgcg gcgaccgagt
     tgctcttgcc cggcgtcaac acgggataat accgcgccac atagcagaac tttaaaagtg
     ctcatcattg gaaaacgttc ttcggggcga aaactctcaa ggatcttacc gctgttgaga
     tccagttcga tgtaacccac tcgtgcaccc aactgatctt cagcatcttt tactttcacc
     agcgtttctg ggtgagcaaa aacaggaagg caaaatgccg caaaaaaggg aataagggcg
     acacggaaat gttgaatact catactcttc ctttttcaat attattgaag catttatcag
     ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg
     gttccgcgca catttccccg aaaagtgcca cctgacgtct aagaaaccat tattatcatg
     acattaacct ataaaaatag gcgtatcacg aggccctttc gtcttcaaga attctcatgt
     ttgacagctt atcatcgata agctgatcct cacaggccgc acccagcttt tcttccgttg
     ccccagtagc atctctgtct ggtgaccttg aagaggaaga ggaggggtcc cgagaatccc
     catccctacc gtccagcaaa aagggggacg aggaatttga ggcctggctt gaggctcagg
     acgcaaatct tgaggatgtt cagcgggagt tttccgggct gcgagtaatt ggtgatgagg
     acgaggatgg ttcggaggat ggggaatttt cagacctgga tctgtctgac agcgaccatg
     aaggggatga gggtgggggg gctgttggag ggggcaggag tctgcactcc ctgtattcac
     tgagcgtcgt ctaataaaga tgtctattga tctcttttag tgtgaatcat gtctgacgag
     gggccaggta caggacctgg aaatggccta ggagagaagg gagacacatc tggaccagaa
     ggctccggcg gcagtggacc tcaaagaaga gggggtgata accatggacg aggacgggga
     agaggacgag gacgaggagg cggaagacca ggagccccgg gcggctcagg atcagggcca
     agacatagag atggtgtccg gagaccccaa aaacgtccaa gttgcattgg ctgcaaaggg
     acccacggtg gaacaggagc aggagcagga gcgggagggg caggagcagg aggggcagga
     gggaggccgg ggtcgaggag gtagtggagg ccggggtcga ggaggtagtg gaggccgccg
     gggtagagga cgtgaaagag ccaggggggg aagtcgtgaa agagccaggg ggagaggtcg
     tggacgtgga gaaaagaggc ccaggagtcc cagtagtcag tcatcatcat ccgggtctcc
     accgcgcagg ccccctccag gtagaaggcc atttttccac cctgtagggg aagccgatta
     ttttgaatac caccaagaag gtggcccaga tggtgagcct gacgtgcccc cgggagcgat
     agagcagggc cccgcagatg acccaggaga aggcccaagc actggacccc ggggtcaggg
     tgatggaggc aggcgcaaaa aaggagggtg gtttggaaag catcgtggtc aaggaggttc
     caacccgaaa tttgagaaca ttgcagaagg tttaagagct ctcctggcta ggagtcacgt
     agaaaggact accgacgaag gaacttgggt cgccggtgtg ttcgtatatg gaggtagtaa
     gacctccctt tacaacctaa ggcgaggaac tgcccttgct attccacaat gtcgtcttac
     accattgagt cgtctcccct ttggaatggc ccctggaccc ggcccacaac ctggcccgct
     aagggagtcc attgtctgtt atttcatggt ctttttacaa actcatatat ttgctgaggt
     tttgaaggat gcgattaagg accttgttat gacaaagccc gctcctacct gcaatatcag
     ggtgactgtg tgcagctttg acgatggagt agatttgcct ccctggtttc cacctatggt
     ggaaggggct gccgcggagg gtgatgacgg agatgacgga gatgaaggag gtgatggaga
     tgagggtgag gaagggcagg agtgatgtaa cttgttagga gacgccctca atcgtattaa
     aagccgtgta ttcccccgca ctaaagaata aatccccagt agacatcatg cgtgctgttg
     gtgtatttct ggccatctgt cttgtcacca ttttcgtcct cccaacatgg ggcaattggg
     catacccatg ttgtcacgtc actcagctcc gcgctcaaca ccttctcgcg ttggaaaaca
     ttagcgacat ttacctggtg agcaatcaga catgcgacgg ctttagcctg gcctccttaa
     attcacctaa gaatgggagc aaccagcatg caggaaaagg acaagcagcg aaaattcacg
     cccccttggg aggtggcggc atatgcaaag gatagcactc ccactctact actgggtatc
     atatgctgac tgtatatgca tgaggatagc atatgctacc cggatacaga ttaggatagc
     atatactacc cagatataga ttaggatagc atatgctacc cagatataga ttaggatagc
     ctatgctacc cagatataaa ttaggatagc atatactacc cagatataga ttaggatagc
     atatgctacc cagatataga ttaggatagc ctatgctacc cagatataga ttaggatagc
     atatgctacc cagatataga ttaggatagc atatgctatc cagatatttg ggtagtatat
     gctacccaga tataaattag gatagcatat actaccctaa tctctattag gatagcatat
     gctacccgga tacagattag gatagcatat actacccaga tatagattag gatagcatat
     gctacccaga tatagattag gatagcctat gctacccaga tataaattag gatagcatat
     actacccaga tatagattag gatagcatat gctacccaga tatagattag gatagcctat
     gctacccaga tatagattag gatagcatat gctatccaga tatttgggta gtatatgcta
     cccatggcaa cattagccca ccgtgctctc agcgacctcg tgaatatgag gaccaacaac
     cctgtgcttg gcgctcaggc gcaagtgtgt gtaatttgtc ctccagatcg cagcaatcgc
     gcccctatct tggcccgccc acctacttat gcaggtattc cccggggtgc cattagtggt
     tttgtgggca agtggtttga ccgcagtggt tagcggggtt acaatcagcc aagttattac
     acccttattt tacagtccaa aaccgcaggg cggcgtgtgg gggctgacgc gtgcccccac
     tccacaattt caaaaaaaag agtggccact tgtctttgtt tatgggcccc attggcgtgg
     agccccgttt aattttcggg ggtgttagag acaaccagtg gagtccgctg ctgtcggcgt
     ccactctctt tccccttgtt acaaatagag tgtaacaaca tggttcacct gtcttggtcc
     ctgcctggga cacatcttaa taaccccagt atcatattgc actaggatta tgtgttgccc
     atagccataa attcgtgtga gatggacatc cagtctttac ggcttgtccc caccccatgg
     atttctattg ttaaagatat tcagaatgtt tcattcctac actagtattt attgcccaag
     gggtttgtga gggttatatt ggtgtcatag cacaatgcca ccactgaacc ccccgtccaa
     attttattct gggggcgtca cctgaaacct tgttttcgag cacctcacat acaccttact
     gttcacaact cagcagttat tctattagct aaacgaagga gaatgaagaa gcaggcgaag
     attcaggaga gttcactgcc cgctccttga tcttcagcca ctgcccttgt gactaaaatg
     gttcactacc ctcgtggaat cctgacccca tgtaaataaa accgtgacag ctcatggggt
     gggagatatc gctgttcctt aggacccttt tactaaccct aattcgatag catatgcttc
     ccgttgggta acatatgcta ttgaattagg gttagtctgg atagtatata ctactacccg
     ggaagcatat gctacccgtt tagggttaac aagggggcct tataaacact attgctaatg
     ccctcttgag ggtccgctta tcggtagcta cacaggcccc tctgattgac gttggtgtag
     cctcccgtag tcttcctggg cccctgggag gtacatgtcc cccagcattg gtgtaagagc
     ttcagccaag agttacacat aaaggcaatg ttgtgttgca gtccacagac tgcaaagtct
     gctccaggat gaaagccact cagtgttggc aaatgtgcac atccatttat aaggatgtca
     actacagtca gagaacccct ttgtgtttgg tccccccccg tgtcacatgt ggaacagggc
     ccagttggca agttgtacca accaactgaa gggattacat gcactgcccc gaatacaaaa
     caaaagcgct cctcgtacca gcgaagaagg ggcagagatg ccgtagtcag gtttagttcg
     tccggcggcg gggc
//