back Return to this vector's summary.
ID   PREP8      preliminary; circular DNA; SYN; 11811 BP.
XX
AC   IG1108; K01383;
XX
DT   01-FEB-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pREP8 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pcDV1/S2 from pcDV1 & linker
RC   pRSVCAT/H2 from pRSVcat & linker
RC   [pBT from BT gene]
RC   pRSV/BT from pRSVCAT/H2 & pBT
RC   pRSVPA1 from pRSV/BT & pcDV1/S2
RC   pRSVPA2 from pRSVPA1 & linker
RC   p220.2 from p201
RC   p220.2/B- from p220.2
RC   pREP2 from pRSVPA2 & p220.2/B-
RC   pREP3 from pREP2
RC   p220.2/XS from p220.2/B-
RC   pHS1PA4 from pRSVPA2
RC   pMEP4 from p220.2/XS & pHS1PA4
RC   pRSVCAT-B2 from pRSVcat & linker
RC   pRSVCAT-B2K from pRSVCAT-B2 & linker
RC   pREP4 from pRSVCAT-B2K & pMEP4
RC   pREP5 from pREP4 & oligo
RA   Groger R.K., Morrow D.M., Tykocinski M.L.;
RT   "Directional antisense and sense cDNA cloning using Epstein-Barr
RT   virus episomal expression vectors";
RL   Gene 81:285-294(1989).
XX
CC   NM (pREP8)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (Invitrogen)
CC   HO (E.coli NM522)(E.coli INValphaF')(mammal)
CC   CP ()
CC   FN (expression)
CC   SE ()
CC   PA (EBV)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pREP4 KpnI-BamHI 10128bp 462..10183..407
FT                   2. oligo
FT                   BamHI-NaeI-StuI-XhoI-NotI-NheI-HindIII-PvuII-KpnI 60bp
FT                   \ gatcggtaccagctgaagcttgctagcggccgctcgaggccggcaaggcc
FT                   \ ggatccgtac
FT                   -> pREP5 10188bp
FT                   1. pREP5 10188bp
FT                   -> pREP8 11811bp"
FT   misc_binding    1..1
FT                   /note="SIT XbaI"
FT   polyA_signal    0..0
FT                   /note="PLA SV40 early gene"
FT   misc_binding    0..0
FT                   /note="MCS
FT                   BamHI-XhoI-NotI-NheI-HindIII-NheI-KpnI"
FT   promoter        complement(0..0)
FT                   /note="PRO Rous sarcoma virus (RSV) long terminal
FT                   repeat (LTR)"
FT   misc_binding    859..859
FT                   /note="SIT NruI"
FT   polyA_signal    0..0
FT                   /note="PLA SV40 thymidine kinase (TK) gene"
FT   CDS             complement(0..0)
FT                   /note="ANT E. coli histidinol dehydrogenase gene
FT                   histidinol resistance gene (his)"
FT   promoter        complement(0..0)
FT                   /note="PRO SV40"
FT   misc_binding    2747..2747
FT                   /note="SIT TthIIII"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             complement(0..0)
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   misc_binding    6825..6825
FT                   /note="SIT BstEII"
FT   CDS             0..0
FT                   /note="GEN Epstein-Barr virus nuclear antigen gene
FT                   (EBNA-1)"
FT   misc_binding    8609..8609
FT                   /note="SIT SacI"
FT   rep_origin      0..0
FT                   /note="ORI Epstein-Barr virus (EBV) oriP"
FT   misc_binding    11037..11037
FT                   /note="SIT EcoRV"
XX
SQ   Sequence 11811 BP; 3010 A; 2789 C; 3272 G; 2740 T; 0 other;
     tctagagtcg accggtcatg gctgcgcccc gacacccgcc aacacccgct gacgcgccct
     gacgggcttg tctgctcccg gcatccgctt acagacaagc tgtgaccgtc tccgggagct
     gcatgtgtca gaggttttca ccgtcatcac cgaaacgcgc gaggcagccg gatcataatc
     agccatacca catttgtaga ggttttactt gctttaaaaa acctccccac ctccccctga
     acctgaaaca taaaatgaat gcaattgttg ttgttaactt gtttattgca gcttataatg
     gttacaaata aagcaatagc atcacaaatt tcacaaataa agcatttttt tcactgcatt
     ctagttgtgg tttgtccaaa ctcatcaatg tatcttatca tgtctggatc cggccttgcc
     ggcctcgagc ggccgctagc aagcttgcta gcagctggta cccagcttgg aggtgcacac
     caatgtggtg aatggtcaaa tggcgtttat tgtatcgagc taggcactta aatacaatat
     ctctgcaatg cggaattcag tggttcgtcc aatccatgtc agacccgtct gttgccttcc
     taataaggca cgatcgtacc accttacttc caccaatcgg catgcacggt gctttttctc
     tccttgtaag gcatgttgct aactcatcgt taccatgttg caagactaca agagtattgc
     ataagactac atttccccct ccctatgcaa aagcgaaact actatatcct gaggggactc
     ctaaccgcgt acaaccgaag ccccgctttt cgcctaaaca caccctagtc ccctcagata
     cgcgtatatc tggcccgtac atcgcgaagc agcgcaaaac gcctaaccct aagcagattc
     ttcatgcaat tgtcggtcaa gccttgcctt gttgtagctt aaattttgct cgcgcactac
     tcagcgacct ccaacacaca agcagggagc agatactggc ttaactatgc ggcatcagag
     cagattgtac tgagagtgca ccatacggat ctgcgatgat aagctgtcaa acatgagaat
     tggtcgacct gcagccagct cagatcttga attcctttgc ctaatttaaa tgaggactta
     acctgtggaa atattttgat gtgggaagct gttactgtta aaactgaggt tattggggta
     actgctatgt taaacttgca ttcagggaca caaaaaactc atgaaaatgg tgctggaaaa
     cccattcaag ggtcaaattt tcattttttt gctgttggtg gggaaccttt ggagctgcag
     ggtgtgttag caaactacag gaccaaatat cctgctcaaa ctgtaacccc aaaaaatgct
     acagttgaca gtcagcagat gaacactgac cacaaggctg ttttggataa ggaaatgctt
     atccagtgga gtgctgggtt cctgatccaa gtaaaaatga aaacactaga tattttggaa
     cctacacagg tggggaaaat gtgcctcctg ttttgcacat tactaacaca gcaaccacag
     tgcttcttga tgagcagggt gttgggccct tgtgcaaagc tgacagcttg tatgtttctg
     ctgttgacat ttgtgggctg tttaccaaca cttctggaac acagcagtgg aagggacttc
     ccagatattt taaaattacc cttagaaagc ggtctgtgaa aaacccctac ccaatttcct
     ttttgttaag tgacctaatt aacaggagga cacagagggt ggatgggcag cctatgattg
     gaatgtcctc tcaagtagag gaggttaggg tttatgagga cacagaggag cttcctgggg
     atcagacatg ataagataca ttgatgagtt tggacaaacc acaactagaa tgcagtgaaa
     aaaatgcttt atttgtgaaa tttgtgatgc tattgcttta tttgtaacca ttataagctg
     caataaacaa gttaacaaca acaattgcat tcattttatg tttcaggttc agggggaggt
     gtgggaggtt ttttaaagca agtaaaacct ctacaaatgt ggtatggctg attatgatct
     ctagtcaagg cactatacat caaatattcc ttattaaccc ctttacaaat taaaaagcta
     aaggtacaca atttttgagc atagttatta atagcagaca ctctatgcct gtgtggagta
     agaaaaaaca gtatgttatg attataactg ttatgcctac ttataaaggt tacagaatat
     ttttccataa ttttcttgta tagcagtgca gctttttcct ttgtggtgta aatagcaaag
     caagcaagag ttctattact aaacacagca tgactcaaaa aacttagcaa ttctgaagga
     aagtccttgg ggtcttctac ctttctcttc ttttttggag gagtagaatg ttgagagtca
     gcagtagcct catcatcact agatggcatt tcttctgagc aaaacaggtt ttcctcatta
     aaggcattcc accactgctc ccattcatca gttccatagg ttggaatcta aaatacacaa
     acaattagaa tcagtagttt aacacattat acacttaaaa attttatatt taccttagag
     ctttaaatct ctgtaggtag tttgtccaat tatgtcacac cacagaagta aggttccttc
     acaaagatcc cgggctaagt cagcgacgct gagagtgttt tcagtgctca tgcttgctcc
     ttgagggcgt ttacgcgcag ggtcacggca tttttatggg cggtcagacg ttctgccgcc
     gccaatgttt caatggttga tgccagagcg gaaaagcccg ctttcgacag ttcctgaacg
     gtcatccgtt tctggaaatc cgctaaccca aggctggaac aggtagcagt atagccatag
     gtcggtaaaa catggttggt tccggaagcg taatcaccgg cggattccgg cgaccagtcg
     ccgagaaata ccgagcctgc gctggtaatc gcatccacca aatcgcgcgc attgcgcgtc
     tggatgatta agtgttccgg cccatactga ttagagatgg cgacgcactg cgctaaatct
     ttggtcacaa tcagacgact ggcgctcagg gcctgccggg cggtgtccgc gcgcggcagt
     tccgccagtt gacgttctac cgcctccgcc accttgcggg caatgtcagc atcaggcgtc
     agcaggatca cctgggaatc cgggccgtgc tcagcctggg agagcaggtc agaagcgacg
     aaatccggtg ttgcgccgct gtctgcgatc accagtactt cagacggccc ggctggcata
     tcgatagccg cgccgtcgag acgctggctg acctgacgtt tggcttcggt tacaaaggcg
     ttgccggggc caaaaatttt atccactttc ggtacggact cgctgccgaa ggccagagcg
     gcaatcgcct gcgcgccgcc gacgttaaag atttcctgca cgccacacag ttgcgccgca
     tagaggattt catcagcgat gggcggcggc gagcacagaa ccaccttctg gcatcccgca
     atgcgcgccg gcgtcgccag catcagcacc gttgagaaga gcggagccga gccgccggga
     atatacagac cgacagacga gacgggacgc gtaacctgct ggcaacgcac gcctggctgg
     gtttccacat ctacaggcgg tagcgtctgc gcggaatgga acgtttcaat atttttgacg
     gcagcggtca tcgcctgttt taattcgtcg ctcagacgcg cgccggcggc ggcgatctct
     tcaggggtga cgcgtagcgc tgtcacttct gttttatcaa atttagcgct gtattcacgc
     agggcatcgt caccgcgcgt ttttacatta tccagaatat cgctgaccgt ccgggtaata
     ctgtcagagg cggaaatcgc cggacgcgtc agcagcgcac gctgctgttc agggctacag
     ctgttccagt caatcagggt attgaagctc atggtccggg atctgagctt tttgcaaaag
     cctaggcctc caaaaaagcc tcctcactac ttctggaata gctcagaggc cgaggcggcc
     tcggcctctg cataaaataa aaaaaattag tcagccatgg ggcggagaat gggcggaact
     gggcggagtt aggggcggga tgggcggagt taggggcggg actatggttg ctgactaatt
     gagatgcatg ctttgcatac ttctgcctgc tggggagcct ggttgctgac taattgagat
     gcatgctttg catacttctg cctgctgggg agcctgggga ctttccacac cctaactgac
     acacattcca cagctgcctc gcgcgtttcg gtgatgacgg tgaaaaacct ctgacacatg
     cagctcccgg agacggtcac agcttgtctg taagcggatg ccgggagcag acaagcccgt
     cagggcgcgt cagcgggtgt tggcgggtgt cggggcgcag ccatgaccca gtcacgtagc
     gatagcggag tgtatcagat ctgcgacgcg aggctggatg gccttcccca ttatgattct
     tctcgcttcc ggcggcatcg ggatgcccgc gttgcaggcc atgctgtcca ggcaggtaga
     tgacgaccat cagggacagc ttcaaggatc gctcgcggct cttaccagcc taacttcgat
     cactggaccg ctgatcgtca cggcgattta tgccgcctcg gcgagcacat ggaacgggtt
     ggcatggatt gtaggcgccg ccctatacct tgtctgcctc cccgcgttgc gtcgcggtgc
     atggagccgg gccacctcga cctgaatgga agccggcggc acctcgctaa cggattcacc
     actccaagaa ttggagccaa tcaattcttg cggagaactg tgaatgcgca aaccaaccct
     tggcagaaca tatccatcgc gtccgccatc tccagcagcc gcacgcggcg cagcaaaagg
     ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca taggctccgc ccccctgacg
     agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga ctataaagat
     accaggcgtt tccccctgga agctccctcg tgcgctctcc tgttccgacc ctgccgctta
     ccggatacct gtccgccttt ctcccttcgg gaagcgtggc gctttctcat agctcacgct
     gtaggtatct cagttcggtg taggtcgttc gctccaagct gggctgtgtg cacgaacccc
     ccgttcagcc cgaccgctgc gccttatccg gtaactatcg tcttgagtcc aacccggtaa
     gacacgactt atcgccactg gcagcagcca ctggtaacag gattagcaga gcgaggtatg
     taggcggtgc tacagagttc ttgaagtggt ggcctaacta cggctacact agaaggacag
     tatttggtat ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt
     gatccggcaa acaaaccacc gctggtagcg gtggtttttt tgtttgcaag cagcagatta
     cgcgcagaaa aaaaggatct caagaagatc ctttgatctt ttctacgggg tctgacgctc
     agtggaacga aaactcacgt taagggattt tggtcatgag attatcaaaa aggatcttca
     cctagatcct tttaaattaa aaatgaagtt ttaaatcaat ctaaagtata tatgagtaaa
     cttggtctga cagttaccaa tgcttaatca gtgaggcacc tatctcagcg atctgtctat
     ttcgttcatc catagttgcc tgactccccg tcgtgtagat aactacgata cgggagggct
     taccatctgg ccccagtgct gcaatgatac cgcgagaccc acgctcaccg gctccagatt
     tatcagcaat aaaccagcca gccggaaggg ccgagcgcag aagtggtcct gcaactttat
     ccgcctccat ccagtctatt aattgttgcc gggaagctag agtaagtagt tcgccagtta
     atagtttgcg caacgttgtt gccattgctg caggcatcgt ggtgtcacgc tcgtcgtttg
     gtatggcttc attcagctcc ggttcccaac gatcaaggcg agttacatga tcccccatgt
     tgtgcaaaaa agcggttagc tccttcggtc ctccgatcgt tgtcagaagt aagttggccg
     cagtgttatc actcatggtt atggcagcac tgcataattc tcttactgtc atgccatccg
     taagatgctt ttctgtgact ggtgagtact caaccaagtc attctgagaa tagtgtatgc
     ggcgaccgag ttgctcttgc ccggcgtcaa cacgggataa taccgcgcca catagcagaa
     ctttaaaagt gctcatcatt ggaaaacgtt cttcggggcg aaaactctca aggatcttac
     cgctgttgag atccagttcg atgtaaccca ctcgtgcacc caactgatct tcagcatctt
     ttactttcac cagcgtttct gggtgagcaa aaacaggaag gcaaaatgcc gcaaaaaagg
     gaataagggc gacacggaaa tgttgaatac tcatactctt cctttttcaa tattattgaa
     gcatttatca gggttattgt ctcatgagcg gatacatatt tgaatgtatt tagaaaaata
     aacaaatagg ggttccgcgc acatttcccc gaaaagtgcc acctgacgtc taagaaacca
     ttattatcat gacattaacc tataaaaata ggcgtatcac gaggcccttt cgtcttcaag
     aattctcatg tttgacagct tatcatcgat aagctgatcc tcacaggccg cacccagctt
     ttcttccgtt gccccagtag catctctgtc tggtgacctt gaagaggaag aggaggggtc
     ccgagaatcc ccatccctac cgtccagcaa aaagggggac gaggaatttg aggcctggct
     tgaggctcag gacgcaaatc ttgaggatgt tcagcgggag ttttccgggc tgcgagtaat
     tggtgatgag gacgaggatg gttcggagga tggggaattt tcagacctgg atctgtctga
     cagcgaccat gaaggggatg agggtggggg ggctgttgga gggggcagga gtctgcactc
     cctgtattca ctgagcgtcg tctaataaag atgtctattg atctctttta gtgtgaatca
     tgtctgacga ggggccaggt acaggacctg gaaatggcct aggagagaag ggagacacat
     ctggaccaga aggctccggc ggcagtggac ctcaaagaag agggggtgat aaccatggac
     gaggacgggg aagaggacga ggacgaggag gcggaagacc aggagccccg ggcggctcag
     gatcagggcc aagacataga gatggtgtcc ggagacccca aaaacgtcca agttgcattg
     gctgcaaagg gacccacggt ggaacaggag caggagcagg agcgggaggg gcaggagcag
     gaggggcagg agcaggagga ggggcaggag caggaggagg ggcaggaggg gcaggagggg
     caggaggggc aggagcagga ggaggggcag gagcaggagg aggggcagga ggggcaggag
     gggcaggagc aggaggaggg gcaggagcag gaggaggggc aggaggggca ggagcaggag
     gaggggcagg aggggcagga ggggcaggag caggaggagg ggcaggagca ggaggagggg
     caggaggggc aggagcagga ggaggggcag gaggggcagg aggggcagga gcaggaggag
     gggcaggagc aggaggggca ggaggggcag gaggggcagg agcaggaggg gcaggagcag
     gaggaggggc aggaggggca ggaggggcag gagcaggagg ggcaggagca ggaggggcag
     gagcaggagg ggcaggagca ggaggggcag gaggggcagg agcaggaggg gcaggagggg
     caggagcagg aggggcagga ggggcaggag caggaggagg ggcaggaggg gcaggagcag
     gaggaggggc aggaggggca ggagcaggag gggcaggagg ggcaggagca ggaggggcag
     gaggggcagg agcaggaggg gcaggagggg caggagcagg aggaggggca ggagcaggag
     gggcaggagc aggaggtgga ggccggggtc gaggaggcag tggaggccgg ggtcgaggag
     gtagtggagg ccggggtcga ggaggtagtg gaggccgccg gggtagagga cgtgaaagag
     ccaggggggg aagtcgtgaa agagccaggg ggagaggtcg tggacgtgga gaaaagaggc
     ccaggagtcc cagtagtcag tcatcatcat ccgggtctcc accgcgcagg ccccctccag
     gtagaaggcc atttttccac cctgtagggg aagccgatta ttttgaatac caccaagaag
     gtggcccaga tggtgagcct gacgtgcccc cgggagcgat agagcagggc cccgcagatg
     acccaggaga aggcccaagc actggacccc ggggtcaggg tgatggaggc aggcgcaaaa
     aaggagggtg gtttggaaag catcgtggtc aaggaggttc caacccgaaa tttgagaaca
     ttgcagaagg tttaagagct ctcctggcta ggagtcacgt agaaaggact accgacgaag
     gaacttgggt cgccggtgtg ttcgtatatg gaggtagtaa gacctccctt tacaacctaa
     ggcgaggaac tgcccttgct attccacaat gtcgtcttac accattgagt cgtctcccct
     ttggaatggc ccctggaccc ggcccacaac ctggcccgct aagggagtcc attgtctgtt
     atttcatggt ctttttacaa actcatatat ttgctgaggt tttgaaggat gcgattaagg
     accttgttat gacaaagccc gctcctacct gcaatatcag ggtgactgtg tgcagctttg
     acgatggagt agatttgcct ccctggtttc cacctatggt ggaaggggct gccgcggagg
     gtgatgacgg agatgacgga gatgaaggag gtgatggaga tgagggtgag gaagggcagg
     agtgatgtaa cttgttagga gacgccctca atcgtattaa aagccgtgta ttcccccgca
     ctaaagaata aatccccagt agacatcatg cgtgctgttg gtgtatttct ggccatctgt
     cttgtcacca ttttcgtcct cccaacatgg ggcaattggg catacccatg ttgtcacgtc
     actcagctcc gcgctcaaca ccttctcgcg ttggaaaaca ttagcgacat ttacctggtg
     agcaatcaga catgcgacgg ctttagcctg gcctccttaa attcacctaa gaatgggagc
     aaccagcatg caggaaaagg acaagcagcg aaaattcacg cccccttggg aggtggcggc
     atatgcaaag gatagcactc ccactctact actgggtatc atatgctgac tgtatatgca
     tgaggatagc atatgctacc cggatacaga ttaggatagc atatactacc cagatataga
     ttaggatagc atatgctacc cagatataga ttaggatagc ctatgctacc cagatataaa
     ttaggatagc atatactacc cagatataga ttaggatagc atatgctacc cagatataga
     ttaggatagc ctatgctacc cagatataga ttaggatagc atatgctacc cagatataga
     ttaggatagc atatgctatc cagatatttg ggtagtatat gctacccaga tataaattag
     gatagcatat actaccctaa tctctattag gatagcatat gctacccgga tacagattag
     gatagcatat actacccaga tatagattag gatagcatat gctacccaga tatagattag
     gatagcctat gctacccaga tataaattag gatagcatat actacccaga tatagattag
     gatagcatat gctacccaga tatagattag gatagcctat gctacccaga tatagattag
     gatagcatat gctatccaga tatttgggta gtatatgcta cccatggcaa cattagccca
     ccgtgctctc agcgacctcg tgaatatgag gaccaacaac cctgtgcttg gcgctcaggc
     gcaagtgtgt gtaatttgtc ctccagatcg cagcaatcgc gcccctatct tggcccgccc
     acctacttat gcaggtattc cccggggtgc cattagtggt tttgtgggca agtggtttga
     ccgcagtggt tagcggggtt acaatcagcc aagttattac acccttattt tacagtccaa
     aaccgcaggg cggcgtgtgg gggctgacgc gtgcccccac tccacaattt caaaaaaaag
     agtggccact tgtctttgtt tatgggcccc attggcgtgg agccccgttt aattttcggg
     ggtgttagag acaaccagtg gagtccgctg ctgtcggcgt ccactctctt tccccttgtt
     acaaatagag tgtaacaaca tggttcacct gtcttggtcc ctgcctggga cacatcttaa
     taaccccagt atcatattgc actaggatta tgtgttgccc atagccataa attcgtgtga
     gatggacatc cagtctttac ggcttgtccc caccccatgg atttctattg ttaaagatat
     tcagaatgtt tcattcctac actagtattt attgcccaag gggtttgtga gggttatatt
     ggtgtcatag cacaatgcca ccactgaacc ccccgtccaa attttattct gggggcgtca
     cctgaaacct tgttttcgag cacctcacat acaccttact gttcacaact cagcagttat
     tctattagct aaacgaagga gaatgaagaa gcaggcgaag attcaggaga gttcactgcc
     cgctccttga tcttcagcca ctgcccttgt gactaaaatg gttcactacc ctcgtggaat
     cctgacccca tgtaaataaa accgtgacag ctcatggggt gggagatatc gctgttcctt
     aggacccttt tactaaccct aattcgatag catatgcttc ccgttgggta acatatgcta
     ttgaattagg gttagtctgg atagtatata ctactacccg ggaagcatat gctacccgtt
     tagggttaac aagggggcct tataaacact attgctaatg ccctcttgag ggtccgctta
     tcggtagcta cacaggcccc tctgattgac gttggtgtag cctcccgtag tcttcctggg
     cccctgggag gtacatgtcc cccagcattg gtgtaagagc ttcagccaag agttacacat
     aaaggcaatg ttgtgttgca gtccacagac tgcaaagtct gctccaggat gaaagccact
     cagtgttggc aaatgtgcac atccatttat aaggatgtca actacagtca gagaacccct
     ttgtgtttgg tccccccccg tgtcacatgt ggaacagggc ccagttggca agttgtacca
     accaactgaa gggattacat gcactgcccc gaatacaaaa caaaagcgct cctcgtacca
     gcgaagaagg ggcagagatg ccgtagtcag gtttagttcg tccggcggcg g
//