back Return to this vector's summary.
ID   PREP9      preliminary; circular DNA; SYN; 10487 BP.
XX
AC   IG1109; K01383;
XX
DT   01-FEB-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pREP9 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pcDV1/S2 from pcDV1 & linker
RC   pRSVCAT/H2 from pRSVcat & linker
RC   [pBT from BT gene]
RC   pRSV/BT from pRSVCAT/H2 & pBT
RC   pRSVPA1 from pRSV/BT & pcDV1/S2
RC   pRSVPA2 from pRSVPA1 & linker
RC   p220.2 from p201
RC   p220.2/B- from p220.2
RC   pREP2 from pRSVPA2 & p220.2/B-
RC   pREP3 from pREP2
RC   p220.2/XS from p220.2/B-
RC   pHS1PA4 from pRSVPA2
RC   pMEP4 from p220.2/XS & pHS1PA4
RC   pRSVCAT-B2 from pRSVcat & linker
RC   pRSVCAT-B2K from pRSVCAT-B2 & linker
RC   pREP4 from pRSVCAT-B2K & pMEP4
RC   pREP5 from pREP4 & oligo
RA   Groger R.K., Morrow D.M., Tykocinski M.L.;
RT   "Directional antisense and sense cDNA cloning using Epstein-Barr
RT   virus episomal expression vectors";
RL   Gene 81:285-294(1989).
XX
CC   NM (pREP9)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (Invitrogen)
CC   HO (E.coli NM522)(E.coli INValphaF')(mammal)
CC   CP ()
CC   FN (expression)
CC   SE ()
CC   PA (EBV)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pREP4 KpnI-BamHI 10128bp 462..10183..407
FT                   2. oligo
FT                   BamHI-NaeI-StuI-XhoI-NotI-NheI-HindIII-PvuII-KpnI 60bp
FT                   \ gatcggtaccagctgaagcttgctagcggccgctcgaggccggcaaggcc
FT                   \ ggatccgtac
FT                   -> pREP5 10188bp
FT                   1. pREP5 10188bp
FT                   -> pREP9 10487bp"
FT   misc_binding    1..1
FT                   /note="SIT XbaI"
FT   promoter        0..0
FT                   /note="PRO Rous sarcoma virus (RSV) long terminal
FT                   repeat (LTR)"
FT   misc_binding    0..0
FT                   /note="MCS
FT                   KpnI-NheI-HindIII-NheI-NotI-XhoI-SfiI-BamHI"
FT   polyA_signal    0..0
FT                   /note="PLA SV40 early gene"
FT   polyA_signal    0..0
FT                   /note="PLA SV40 thymidine kinase (TK) gene"
FT   CDS             complement(0..0)
FT                   /note="ANT E. coli neomycin phosphotransferase gene
FT                   (NPT), neomycin resistance gene (neo)"
FT   promoter        complement(0..0)
FT                   /note="PRO SV40 thymidine kinase (TK) gene"
FT   misc_binding    3118..3118
FT                   /note="SIT BglII"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             complement(0..0)
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   misc_binding    5171..5171
FT                   /note="SIT XmnI"
FT   misc_binding    5594..5594
FT                   /note="SIT ClaI"
FT   misc_binding    5740..5740
FT                   /note="SIT StuI"
FT   CDS             0..0
FT                   /note="GEN Epstein-Barr virus nuclear antigen gene
FT                   (EBNA-1)"
FT   misc_binding    7445..7445
FT                   /note="SIT SacI"
FT   rep_origin      0..0
FT                   /note="ORI Epstein-Barr virus (EBV) oriP"
FT   misc_binding    9874..9874
FT                   /note="SIT EcoRV"
XX
SQ   Sequence 10487 BP; 2553 A; 2567 C; 3090 G; 2277 T; 0 other;
     tctagagtcg accaattctc atgtttgaca gcttatcatc gcagatcctg agcttgtatg
     gtgcactctc agtacaatct gctctgctgc cgcatagtta agccagtatc tgctccctgc
     ttgtgtgttg gaggtcgctg agtagtgcgc gagcaaaatt taagctacaa caaggcaagg
     cttgaccgac aattgcatga agaatctgct tagggttagg cgttttgcgc tgcttcgcga
     tgtacgggcc agatatacgc gtatctgagg ggactagggt gtgtttaggc gcccagcggg
     gcttcggttg tacgcggtta ggagtcccct caggatatag tagtttcgct tttgcatagg
     gagggggaaa tgtagtctta tgcaatacac ttgtagtctt gcaacatggt aacgatgagt
     tagcaacatg ccttacaagg agagaaaaag caccgtgcat gccgattggt ggaagtaagg
     tggtacgatc gtgccttatt aggaaggcaa cagacaggtc tgacatggat tggacgaacc
     actgaattcc gcattgcaga gataattgta tttaagtgcc tagctcgata caataaacgc
     catttgacca ttcaccacat tggtgtgcac ctccaagctg ggtaccagct gctagcaagc
     ttgctagcgg ccgctcgagg ccggcaaggc cggatccaga catgataaga tacattgatg
     agtttggaca aaccacaact agaatgcagt gaaaaaaatg ctttatttgt gaaatttgtg
     atgctattgc tttatttgta accattataa gctgcaataa acaagttaac aacaacaatt
     gcattcattt tatgtttcag gttcaggggg aggtggggag gttttttaaa gcaagtaaaa
     cctctacaaa tgtggtatgg ctgattatga tccggctgcc tcgcgcgttt cggtgatgac
     ggtgaaaacc tctgacacat gcagctcccg gagacggtca cagcttgtct gtaagcggat
     gccgggagca gacaagcccg tcagggcgcg tcagcgggtg ttggcgggtg tcggggcgca
     gccatgaccg gtcgactgca gatcctctac gccggacgca tcgtggccgg catcaccggc
     gccacaggtg cggttgctgg cgcctatatc gccgacatca ccgatgggga agatcgggct
     cgccacttcg ggctcatgag cgcttgtttc ggcgtgggta tggtggcagg ccccgtggcc
     gggggactgt tgggcgccat ctccttgcat gcaccattcc ttgcggcggc ggtgctcaac
     ggcctcaacc tactactggg ctgcttccta atgcaggagt cgcataaggg agagcgtcga
     ccgatgccct tgagagcctt caacccagtc agctccttcc ggtgggcgcg gggcatgact
     atcgtcgccg cacttatgac tgtcttcttt atcatgcaac tcgtaggaca ggtgccctgg
     ccggggtccc gcggaaactc ggccgtggtg accaatacaa aacaaaagcg ctcctcgtac
     cagcgaagaa ggggcagaga tgccgtagtc aggtttagtt cgtccggcgg cgccagaaat
     ccgcgcggtg gtttttgggg gtcgggggtg tttggcagcc acagacgccc ggtgttcgtg
     tcgcgccagt acatgcggtc catgcccagg ccatccaaaa accatgggtc tgtctgctca
     gtccagtcgt ggacctgacc ccacgcaacg cccaaaataa taacccccac gaaccataaa
     ccattcccca tgggggaccc cgtccctaac ccacggggcc cgtggctatg gcgggcttgc
     cgccccgacg ttggctgcga gccctgggcc ttcacccgaa cttgggggtt ggggtgggga
     aaaggaagaa acgcgggcgt attggcccca atggggtctc ggtggggtat cgacagagtg
     ccagccctgg gaccgaaccc cgcgtttatg aacaaacgac ccaacacccg tgcgttttat
     tctgtctttt tattgccgtc atagcgcggg ttccttccgg tattgtctcc ttccgtgttt
     cagttagcct cccccatctc ccgggggtgg gcgaagaact ccagcatgag atccccgcgc
     tggaggatca tccagccggc gtcccggaaa acgattccga agcccaacct ttcatagaag
     gcggcggtgg aatcgaaatc tcgtgatggc aggttgggcg tcgcttggtc ggtcatttcg
     aaccccagag tcccgctcag aagaactcgt caagaaggcg atagaaggcg atgcgctgcg
     aatcgggagc ggcgataccg taaagcacga ggaagcggtc agcccattcg ccgccaagct
     cttcagcaat atcacgggta gccaacgcta tgtcctgata gcggtccgcc acacccagcc
     ggccacagtc gatgaatcca gaaaagcggc cattttccac catgatattc ggcaagcagg
     catcgccatg ggtcacgacg agatcctcgc cgtcgggcat gcgcgccttg agcctggcga
     acagttcggc tggcgcgagc ccctgatgct cttcgtccag atcatcctga tcgacaagac
     cggcttccat ccgagtacgt gctcgctcga tgcgatgttt cgcttggtgg tcgaatgggc
     aggtagccgg atcaagcgta tgcagccgcc gcattgcatc agccatgatg gatactttct
     cggcaggagc aaggtgagat gacaggagat cctgccccgg cacttcgccc aatagcagcc
     agtcccttcc cgcttcagtg acaacgtcga gcacagctgc gcaaggaacg cccgtcgtgg
     ccagccacga tagccgcgct gcctcgtcct gcagttcatt cagggcaccg gacaggtcgg
     tcttgacaaa aagaaccggg cgcccctgcg ctgacagccg gaacacggcg gcatcagagc
     agccgattgt ctgttgtgcc cagtcatagc cgaatagcct ctccacccaa gcggccggag
     aacctgcgtg caatccatct tgttcaatca tgcgaaacga tcctcatcct gtctcttgat
     cagatcttgc ggcacgctgt tgacgctgtt aagcgggtcg ctgcagggtc gctcggtgtt
     cgaggccaca cgcgtcacct taatatgcga agtggacctg ggaccgcgcc gccccgactg
     catctgcgtg ttcgaattcg ccaatgacaa gacgctgggc ggggtttgtg tcatcataga
     actaaagaca tgcaaatata tttcttccgg ggacaccgcc agcaaacgcg agcaacgggc
     cacggggatg aagcagggcg gcacctcgct aacggattca ccactccaag aattggagcc
     aatcaattct tgcggagaac tgtgaatgcg caaaccaacc cttggcagaa catatccatc
     gcgtccgcca tctccagcag ccgcacgcgg cgcatctcgg ggccgacgcg ctgggctacg
     tcttgctggc gttcgcgacg cgaggctgga tggccttccc cattatgatt cttctcgctt
     ccggcggcat cgggatgccc gcgttgcagg ccatgctgtc caggcaggta gatgacgacc
     atcagggaca gcttcaagga tcgctcgcgg ctcttaccag cgccagcaaa aggccaggaa
     ccgtaaaaag gccgcgttgc tggcgttttt ccataggctc cgcccccctg acgagcatca
     caaaaatcga cgctcaagtc agaggtggcg aaacccgaca ggactataaa gataccaggc
     gtttccccct ggaagctccc tcgtgcgctc tcctgttccg accctgccgc ttaccggata
     cctgtccgcc tttctccctt cgggaagcgt ggcgctttct caatgctcac gctgtaggta
     tctcagttcg gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac cccccgttca
     gcccgaccgc tgcgccttat ccggtaacta tcgtcttgag tccaacccgg taagacacga
     cttatcgcca ctggcagcag ccactggtaa caggattagc agagcgaggt atgtaggcgg
     tgctacagag ttcttgaagt ggtggcctaa ctacggctac actagaagga cagtatttgg
     tatctgcgct ctgctgaagc cagttacctt cggaaaaaga gttggtagct cttgatccgg
     caaacaaacc accgctggta gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag
     aaaaaaagga tctcaagaag atcctttgat cttttctacg gggtctgacg ctcagtggaa
     cgaaaactca cgttaaggga ttttggtcat gagattatca aaaaggatct tcacctagat
     ccttttaaat taaaaatgaa gttttaaatc aatctaaagt atatatgagt aaacttggtc
     tgacagttac caatgcttaa tcagtgaggc acctatctca gcgatctgtc tatttcgttc
     atccatagtt gcctgactcc ccgtcgtgta gataactacg atacgggagg gcttaccatc
     tggccccagt gctgcaatga taccgcgaga cccacgctca ccggctccag atttatcagc
     aataaaccag ccagccggaa gggccgagcg cagaagtggt cctgcaactt tatccgcctc
     catccagtct attaattgtt gccgggaagc tagagtaagt agttcgccag ttaatagttt
     gcgcaacgtt gttgccattg ctgcaggcat cgtggtgtca cgctcgtcgt ttggtatggc
     ttcattcagc tccggttccc aacgatcaag gcgagttaca tgatccccca tgttgtgcaa
     aaaagcggtt agctccttcg gtcctccgat cgttgtcaga agtaagttgg ccgcagtgtt
     atcactcatg gttatggcag cactgcataa ttctcttact gtcatgccat ccgtaagatg
     cttttctgtg actggtgagt actcaaccaa gtcattctga gaatagtgta tgcggcgacc
     gagttgctct tgcccggcgt caacacggga taataccgcg ccacatagca gaactttaaa
     agtgctcatc attggaaaac gttcttcggg gcgaaaactc tcaaggatct taccgctgtt
     gagatccagt tcgatgtaac ccactcgtgc acccaactga tcttcagcat cttttacttt
     caccagcgtt tctgggtgag caaaaacagg aaggcaaaat gccgcaaaaa agggaataag
     ggcgacacgg aaatgttgaa tactcatact cttccttttt caatattatt gaagcattta
     tcagggttat tgtctcatga gcggatacat atttgaatgt atttagaaaa ataaacaaat
     aggggttccg cgcacatttc cccgaaaagt gccacctgac gtctaagaaa ccattattat
     catgacatta acctataaaa ataggcgtat cacgaggccc tttcgtcttc aagaattctc
     atgtttgaca gcttatcatc gataagctga tcctcacagg ccgcacccag cttttcttcc
     gttgccccag tagcatctct gtctggtgac cttgaagagg aagaggaggg gtcccgagaa
     tccccatccc taccgtccag caaaaagggg gacgaggaat ttgaggcctg gcttgaggct
     caggacgcaa atcttgagga tgttcagcgg gagttttccg ggctgcgagt aattggtgat
     gaggacgagg atggttcgga ggatggggaa ttttcagacc tggatctgtc tgacagcgac
     catgaagggg atgagggtgg gggggctgtt ggagggggca ggagtctgca ctccctgtat
     tcactgagcg tcgtctaata aagatgtcta ttgatctctt ttagtgtgaa tcatgtctga
     cgaggggcca ggtacaggac ctggaaatgg cctaggagag aagggagaca catctggacc
     agaaggctcc ggcggcagtg gacctcaaag aagagggggt gataaccatg gacgaggacg
     gggaagagga cgaggacgag gaggcggaag accaggagcc ccgggcggct caggatcagg
     gccaagacat agagatggtg tccggagacc ccaaaaacgt ccaagttgca ttggctgcaa
     agggacccac ggtggaacag gagcaggagc aggagcggga ggggcaggag caggaggggc
     aggagcagga ggaggggcag gagcaggagg aggggcagga ggggcaggag gggcaggagg
     ggcaggagca ggaggagggg caggagcagg aggaggggca ggaggggcag gaggggcagg
     agcaggagga ggggcaggag caggaggagg ggcaggaggg gcaggagcag gaggaggggc
     aggaggggca ggaggggcag gagcaggagg aggggcagga gcaggaggag gggcaggagg
     ggcaggagca ggaggagggg caggaggggc aggaggggca ggagcaggag gaggggcagg
     agcaggaggg gcaggagggg caggaggggc aggagcagga ggggcaggag caggaggagg
     ggcaggaggg gcaggagggg caggagcagg aggggcagga gcaggagggg caggagcagg
     aggggcagga gcaggagggg caggaggggc aggagcagga ggggcaggag gggcaggagc
     aggaggggca ggaggggcag gagcaggagg aggggcagga ggggcaggag caggaggagg
     ggcaggaggg gcaggagcag gaggggcagg aggggcagga gcaggagggg caggaggggc
     aggagcagga ggggcaggag gggcaggagc aggaggaggg gcaggagcag gaggggcagg
     agcaggaggt ggaggccggg gtcgaggagg cagtggaggc cggggtcgag gaggtagtgg
     aggccggggt cgaggaggta gtggaggccg ccggggtaga ggacgtgaaa gagccagggg
     gggaagtcgt gaaagagcca gggggagagg tcgtggacgt ggagaaaaga ggcccaggag
     tcccagtagt cagtcatcat catccgggtc tccaccgcgc aggccccctc caggtagaag
     gccatttttc caccctgtag gggaagccga ttattttgaa taccaccaag aaggtggccc
     agatggtgag cctgacgtgc ccccgggagc gatagagcag ggccccgcag atgacccagg
     agaaggccca agcactggac cccggggtca gggtgatgga ggcaggcgca aaaaaggagg
     gtggtttgga aagcatcgtg gtcaaggagg ttccaacccg aaatttgaga acattgcaga
     aggtttaaga gctctcctgg ctaggagtca cgtagaaagg actaccgacg aaggaacttg
     ggtcgccggt gtgttcgtat atggaggtag taagacctcc ctttacaacc taaggcgagg
     aactgccctt gctattccac aatgtcgtct tacaccattg agtcgtctcc cctttggaat
     ggcccctgga cccggcccac aacctggccc gctaagggag tccattgtct gttatttcat
     ggtcttttta caaactcata tatttgctga ggttttgaag gatgcgatta aggaccttgt
     tatgacaaag cccgctccta cctgcaatat cagggtgact gtgtgcagct ttgacgatgg
     agtagatttg cctccctggt ttccacctat ggtggaaggg gctgccgcgg agggtgatga
     cggagatgac ggagatgaag gaggtgatgg agatgagggt gaggaagggc aggagtgatg
     taacttgtta ggagacgccc tcaatcgtat taaaagccgt gtattccccc gcactaaaga
     ataaatcccc agtagacatc atgcgtgctg ttggtgtatt tctggccatc tgtcttgtca
     ccattttcgt cctcccaaca tggggcaatt gggcataccc atgttgtcac gtcactcagc
     tccgcgctca acaccttctc gcgttggaaa acattagcga catttacctg gtgagcaatc
     agacatgcga cggctttagc ctggcctcct taaattcacc taagaatggg agcaaccagc
     atgcaggaaa aggacaagca gcgaaaattc acgccccctt gggaggtggc ggcatatgca
     aaggatagca ctcccactct actactgggt atcatatgct gactgtatat gcatgaggat
     agcatatgct acccggatac agattaggat agcatatact acccagatat agattaggat
     agcatatgct acccagatat agattaggat agcctatgct acccagatat aaattaggat
     agcatatact acccagatat agattaggat agcatatgct acccagatat agattaggat
     agcctatgct acccagatat agattaggat agcatatgct acccagatat agattaggat
     agcatatgct atccagatat ttgggtagta tatgctaccc agatataaat taggatagca
     tatactaccc taatctctat taggatagca tatgctaccc ggatacagat taggatagca
     tatactaccc agatatagat taggatagca tatgctaccc agatatagat taggatagcc
     tatgctaccc agatataaat taggatagca tatactaccc agatatagat taggatagca
     tatgctaccc agatatagat taggatagcc tatgctaccc agatatagat taggatagca
     tatgctatcc agatatttgg gtagtatatg ctacccatgg caacattagc ccaccgtgct
     ctcagcgacc tcgtgaatat gaggaccaac aaccctgtgc ttggcgctca ggcgcaagtg
     tgtgtaattt gtcctccaga tcgcagcaat cgcgccccta tcttggcccg cccacctact
     tatgcaggta ttccccgggg tgccattagt ggttttgtgg gcaagtggtt tgaccgcagt
     ggttagcggg gttacaatca gccaagttat tacaccctta ttttacagtc caaaaccgca
     gggcggcgtg tgggggctga cgcgtgcccc cactccacaa tttcaaaaaa aagagtggcc
     acttgtcttt gtttatgggc cccattggcg tggagccccg tttaattttc gggggtgtta
     gagacaacca gtggagtccg ctgctgtcgg cgtccactct ctttcccctt gttacaaata
     gagtgtaaca acatggttca cctgtcttgg tccctgcctg ggacacatct taataacccc
     agtatcatat tgcactagga ttatgtgttg cccatagcca taaattcgtg tgagatggac
     atccagtctt tacggcttgt ccccacccca tggatttcta ttgttaaaga tattcagaat
     gtttcattcc tacactagta tttattgccc aaggggtttg tgagggttat attggtgtca
     tagcacaatg ccaccactga accccccgtc caaattttat tctgggggcg tcacctgaaa
     ccttgttttc gagcacctca catacacctt actgttcaca actcagcagt tattctatta
     gctaaacgaa ggagaatgaa gaagcaggcg aagattcagg agagttcact gcccgctcct
     tgatcttcag ccactgccct tgtgactaaa atggttcact accctcgtgg aatcctgacc
     ccatgtaaat aaaaccgtga cagctcatgg ggtgggagat atcgctgttc cttaggaccc
     ttttactaac cctaattcga tagcatatgc ttcccgttgg gtaacatatg ctattgaatt
     agggttagtc tggatagtat atactactac ccgggaagca tatgctaccc gtttagggtt
     aacaaggggg ccttataaac actattgcta atgccctctt gagggtccgc ttatcggtag
     ctacacaggc ccctctgatt gacgttggtg tagcctcccg tagtcttcct gggcccctgg
     gaggtacatg tcccccagca ttggtgtaag agcttcagcc aagagttaca cataaaggca
     atgttgtgtt gcagtccaca gactgcaaag tctgctccag gatgaaagcc actcagtgtt
     ggcaaatgtg cacatccatt tataaggatg tcaactacag tcagagaacc cctttgtgtt
     tggtcccccc ccgtgtcaca tgtggaacag ggcccagttg gcaagttgta ccaaccaact
     gaagggatta catgcactgc cccgaataca aaacaaaagc gctcctcgta ccagcgaaga
     aggggcagag atgccgtagt caggtttagt tcgtccggcg gcggggc
//