back Return to this vector's summary.
ID   PRPM1      preliminary; circular DNA; SYN; 2722 BP.
AC   IG5022;
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
DE   E. coli plasmid vector pRPM1 - complete.
KW   cloning vector.
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
RN   [1]
RC   pRPM1, pRPM2 from pUC19 & oligo
RA   Cease K.B., Lohff C.J.;
RT   "A vector for facile PCR product cloning and modification generating
RT   any desired 4-base 5' overhang: pRPM";
RL   Biotechniques 14:250-255(1993).
CC   Created by Moore, July 1995, under contract with NCBI.
CC   NM (pRPM1)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli JM109)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pUC19)
CC   BR (pRPM2)
CC   OF ()
CC   OR ()
FH   Key             Location/Qualifiers
FT   misc_feature    0..0
FT                   /note="1. pUC19 XmaI/SmaI 2686bp 415..415, MCS
FT                   2. oligo 36bp ccggtccggatggaagacccgggtcttccatccgga
FT                   -> pRPM1 2722bp"
FT   -               1..414
FT                   /note="pUC19 1..414 414bp
FT                   SmaI = XmaI = CCC^GGG
FT                   \                 ccggtc..."
FT   -               415..450
FT                   /note="ccggtccggatggaagacccgggtcttccatccgga 36bp
FT                   \       ...tccgga
FT                   SmaI = XmaI = CCC^GGG"
FT   -               451..2722
FT                   /note="pUC19 415..2686 2272bp"
FT   misc_feature    1..36
FT                   /note="palindromic 36 bp inserted at XmaI site
FT                   of pUC19"
FT   misc_binding    8..21
FT                   /note="SIT FokI"
FT   misc_binding    13..20
FT                   /note="SIT BbsI"
FT   misc_binding    18..23
FT                   /note="SIT SmaI"
FT   misc_binding    21..28
FT                   /note="SIT BbsI"
FT   misc_binding    20..33
FT                   /note="SIT FokI"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
SQ   Sequence 2722 BP; 672 A; 687 C; 698 G; 665 T; 0 other;
     tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca
     cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg
     ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc
     accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc
     attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat
     tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt
     tttcccagtc acgacgttgt aaaacgacgg ccagtgaatt cgagctcggt acccccggtc
     cggatggaag acccgggtct tccatccgga ggggatcctc tagagtcgac ctgcaggcat
     gcaagcttgg cgtaatcatg gtcatagctg tttcctgtgt gaaattgtta tccgctcaca
     attccacaca acatacgagc cggaagcata aagtgtaaag cctggggtgc ctaatgagtg
     agctaactca cattaattgc gttgcgctca ctgcccgctt tccagtcggg aaacctgtcg
     tgccagctgc attaatgaat cggccaacgc gcggggagag gcggtttgcg tattgggcgc
     tcttccgctt cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta
     tcagctcact caaaggcggt aatacggtta tccacagaat caggggataa cgcaggaaag
     aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg
     tttttccata ggctccgccc ccctgacgag catcacaaaa atcgacgctc aagtcagagg
     tggcgaaacc cgacaggact ataaagatac caggcgtttc cccctggaag ctccctcgtg
     cgctctcctg ttccgaccct gccgcttacc ggatacctgt ccgcctttct cccttcggga
     agcgtggcgc tttctcaatg ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc
     tccaagctgg gctgtgtgca cgaacccccc gttcagcccg accgctgcgc cttatccggt
     aactatcgtc ttgagtccaa cccggtaaga cacgacttat cgccactggc agcagccact
     ggtaacagga ttagcagagc gaggtatgta ggcggtgcta cagagttctt gaagtggtgg
     cctaactacg gctacactag aaggacagta tttggtatct gcgctctgct gaagccagtt
     accttcggaa aaagagttgg tagctcttga tccggcaaac aaaccaccgc tggtagcggt
     ggtttttttg tttgcaagca gcagattacg cgcagaaaaa aaggatctca agaagatcct
     ttgatctttt ctacggggtc tgacgctcag tggaacgaaa actcacgtta agggattttg
     gtcatgagat tatcaaaaag gatcttcacc tagatccttt taaattaaaa atgaagtttt
     aaatcaatct aaagtatata tgagtaaact tggtctgaca gttaccaatg cttaatcagt
     gaggcaccta tctcagcgat ctgtctattt cgttcatcca tagttgcctg actccccgtc
     gtgtagataa ctacgatacg ggagggctta ccatctggcc ccagtgctgc aatgataccg
     cgagacccac gctcaccggc tccagattta tcagcaataa accagccagc cggaagggcc
     gagcgcagaa gtggtcctgc aactttatcc gcctccatcc agtctattaa ttgttgccgg
     gaagctagag taagtagttc gccagttaat agtttgcgca acgttgttgc cattgctaca
     ggcatcgtgg tgtcacgctc gtcgtttggt atggcttcat tcagctccgg ttcccaacga
     tcaaggcgag ttacatgatc ccccatgttg tgcaaaaaag cggttagctc cttcggtcct
     ccgatcgttg tcagaagtaa gttggccgca gtgttatcac tcatggttat ggcagcactg
     cataattctc ttactgtcat gccatccgta agatgctttt ctgtgactgg tgagtactca
     accaagtcat tctgagaata gtgtatgcgg cgaccgagtt gctcttgccc ggcgtcaata
     cgggataata ccgcgccaca tagcagaact ttaaaagtgc tcatcattgg aaaacgttct
     tcggggcgaa aactctcaag gatcttaccg ctgttgagat ccagttcgat gtaacccact
     cgtgcaccca actgatcttc agcatctttt actttcacca gcgtttctgg gtgagcaaaa
     acaggaaggc aaaatgccgc aaaaaaggga ataagggcga cacggaaatg ttgaatactc
     atactcttcc tttttcaata ttattgaagc atttatcagg gttattgtct catgagcgga
     tacatatttg aatgtattta gaaaaataaa caaatagggg ttccgcgcac atttccccga
     aaagtgccac ctgacgtcta agaaaccatt attatcatga cattaaccta taaaaatagg
     cgtatcacga ggccctttcg tc