back Return to this vector's summary.
ID   PRSET5A    preliminary; circular DNA; SYN; 2831 BP.
XX
AC   X54202;
XX
DT   15-MAR-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pRSET5a - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-2831
RC   pRSET1d from pBluescript KS+ & pET-3d
RC   pRSET1a, pRSET1b, pRSET1c from pRSET1d & pET-3a
RC   pRSET5 series, pRSET6 series from pRSET1 series & linker MCS
RA   Schoepfer R.;
RT   "The pRSET family of T7 promoter expression vectors for Escherichia
RT   coli";
RL   Gene 124:83-85(1993).
XX
RN   [2]
RP   1-2831
RC   pRSET5a
RA   Schoepfer R.;
RT   ;
RL   Submitted (08-AUG-1990) by:
RL   Schoepfer R., Salk Institute, P.O.Box 85800, San Diego, CA 92138, USA.
XX
CC   This bacterial expression cloning vector contains a T7 promoter,
CC   transcription terminator, translation start site, pUC and phage f1
CC   origins of replication and a polylinker. The plasmid confers
CC   resistance to ampicillin.
CC
CC   See related entries X54202-X54209.
CC   NM (pRSET5A)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pBluescript KS+)(pRSET)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBluescript KS+ PvuII-PvuII 2519bp
FT                   \ 978..2964..533
FT                   2. pET-3d BglII-EcoRV 280bp
FT                   Klenow:Klenow
FT                   -> pRSET1 2800bp
FT                   1. pRSET1 remove XbaI-BamHI 80bp, pET-3d/2720bp
FT                   2. pET-3a XbaI-BamHI 80bp
FT                   -> pRSET1a 2800bp
FT                   1. pRSET1a BamHI 2800bp 533..533
FT                   2. linker MCS BamHI-BamHI 46bp
FT                   \ ggatccgagctcgagatctgcagctggtaccatggaattcgaagctt
FT                   -> pRSET5a 2831bp"
FT   misc_feature    1..318
FT                   /note="contains expression specific sequences"
FT   promoter        20..36
FT                   /note="PRO bacteriophage T7"
FT   misc_feature    37..37
FT                   /note="transcription start"
FT   misc_feature    100..102
FT                   /note="translation start"
FT   misc_binding    136..182
FT                   /note="MCS"
FT   misc_feature    293..293
FT                   /note="TER transcription stop"
FT   misc_feature    319..2831
FT                   /note="from pBluescript KS+"
XX
SQ   Sequence 2831 BP; 704 A; 696 C; 708 G; 723 T; 0 other;
     gatctcgatc ccgcgaaatt aatacgactc actataggga gaccacaacg gtttccctct
     agaaataatt ttgtttaact ttaagaagga gatatacata tggctagcat gactggtgga
     cagcaaatgg gtcgcggatc cgagctcgag atctgcagct ggtaccatgg aattcgaagc
     ttgatccggc tgctaacaaa gcccgaaagg aagctgagtt ggctgctgcc accgctgagc
     aataactagc ataacccctt ggggcctcta aacgggtctt gaggggtttt ttgctgaaag
     gaggaactat atccggatct ggcgtaatag cgaagaggcc cgcaccgatc gcccttccca
     acagttgcgc agcctgaatg gcgaatggga cgcgccctgt agcggcgcat taagcgcggc
     gggtgtggtg gttacgcgca gcgtgaccgc tacacttgcc agcgccctag cgcccgctcc
     tttcgctttc ttcccttcct ttctcgccac gttcgccggc tttccccgtc aagctctaaa
     tcgggggctc cctttagggt tccgatttag tgctttacgg cacctcgacc ccaaaaaact
     tgattagggt gatggttcac gtagtgggcc atcgccctga tagacggttt ttcgcccttt
     gacgttggag tccacgttct ttaatagtgg actcttgttc caaactggaa caacactcaa
     ccctatctcg gtctattctt ttgatttata agggattttg ccgatttcgg cctattggtt
     aaaaaatgag ctgatttaac aaaaatttaa cgcgaatttt aacaaaatat taacgcttac
     aatttaggtg gcacttttcg gggaaatgtg cgcggaaccc ctatttgttt atttttctaa
     atacattcaa atatgtatcc gctcatgaga caataaccct gataaatgct tcaataatat
     tgaaaaagga agagtatgag tattcaacat ttccgtgtcg cccttattcc cttttttgcg
     gcattttgcc ttcctgtttt tgctcaccca gaaacgctgg tgaaagtaaa agatgctgaa
     gatcagttgg gtgcacgagt gggttacatc gaactggatc tcaacagcgg taagatcctt
     gagagttttc gccccgaaga acgttttcca atgatgagca cttttaaagt tctgctatgt
     ggcgcggtat tatcccgtat tgacgccggg caagagcaac tcggtcgccg catacactat
     tctcagaatg acttggttga gtactcacca gtcacagaaa agcatcttac ggatggcatg
     acagtaagag aattatgcag tgctgccata accatgagtg ataacactgc ggccaactta
     cttctgacaa cgatcggagg accgaaggag ctaaccgctt ttttgcacaa catgggggat
     catgtaactc gccttgatcg ttgggaaccg gagctgaatg aagccatacc aaacgacgag
     cgtgacacca cgatgcctgt agcaatggca acaacgttgc gcaaactatt aactggcgaa
     ctacttactc tagcttcccg gcaacaatta atagactgga tggaggcgga taaagttgca
     ggaccacttc tgcgctcggc ccttccggct ggctggttta ttgctgataa atctggagcc
     ggtgagcgtg ggtctcgcgg tatcattgca gcactggggc cagatggtaa gccctcccgt
     atcgtagtta tctacacgac ggggagtcag gcaactatgg atgaacgaaa tagacagatc
     gctgagatag gtgcctcact gattaagcat tggtaactgt cagaccaagt ttactcatat
     atactttaga ttgatttaaa acttcatttt taatttaaaa ggatctaggt gaagatcctt
     tttgataatc tcatgaccaa aatcccttaa cgtgagtttt cgttccactg agcgtcagac
     cccgtagaaa agatcaaagg atcttcttga gatccttttt ttctgcgcgt aatctgctgc
     ttgcaaacaa aaaaaccacc gctaccagcg gtggtttgtt tgccggatca agagctacca
     actctttttc cgaaggtaac tggcttcagc agagcgcaga taccaaatac tgtccttcta
     gtgtagccgt agttaggcca ccacttcaag aactctgtag caccgcctac atacctcgct
     ctgctaatcc tgttaccagt ggctgctgcc agtggcgata agtcgtgtct taccgggttg
     gactcaagac gatagttacc ggataaggcg cagcggtcgg gctgaacggg gggttcgtgc
     acacagccca gcttggagcg aacgacctac accgaactga gatacctaca gcgtgagcta
     tgagaaagcg ccacgcttcc cgaagggaga aaggcggaca ggtatccggt aagcggcagg
     gtcggaacag gagagcgcac gagggagctt ccagggggaa acgcctggta tctttatagt
     cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt tgtgatgctc gtcagggggg
     cggagcctat ggaaaaacgc cagcaacgcg gcctttttac ggttcctggc cttttgctgg
     ccttttgctc acatgttctt tcctgcgtta tcccctgatt ctgtggataa ccgtattacc
     gcctttgagt gagctgatac cgctcgccgc agccgaacga ccgagcgcag cgagtcagtg
     agcgaggaag cggaagagcg cccaatacgc aaaccgcctc tccccgcgcg ttggccgatt
     cattaatgca g
//